Dataset for CDS BCL-2-like of organism Larimichthys crocea

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4D6FTA2_BCL2-05      atggcgaacgag--------------------------------------
A0A4D6FTA2_BCL2-01      --------------------------------------------------
A0A4D6FTA2_BCL2-04      atgtcctctgaagaagggttgagctcaacggtcacggattggcttttcat
A0A4D6FTA2_BCL2-02      atgtcctctgaagaagggttgagctcaacggtcacggattggcttttcat
A0A4D6FTA2_BCL2-03      --------------------------------------------------

A0A4D6FTA2_BCL2-05      ---------------------------------------cgtaaccgcaa
A0A4D6FTA2_BCL2-01      -------------------------------atgctcctcgtagtcgccg
A0A4D6FTA2_BCL2-04      caactcctggtggctccttctgccattcataatgctcctcgtagtcgccg
A0A4D6FTA2_BCL2-02      caactcctggtggctccttctgccattcataatgctcctcgtagtcgccg
A0A4D6FTA2_BCL2-03      -------------------------------atgctcctcgtagtcgccg
                                                               ****  ***  

A0A4D6FTA2_BCL2-05      cat---------------------tgtggaaaagtatatct---------
A0A4D6FTA2_BCL2-01      ccttcatcgtcgccttcgtgttgctgttatacatgatatcgcctcttatt
A0A4D6FTA2_BCL2-04      ccttcatcgtcgccttcgtgttgctgttatacatgatatcgcctcttatt
A0A4D6FTA2_BCL2-02      ccttcatcgtcgccttcgtgttgctgttatacatgatatcgcctcttatt
A0A4D6FTA2_BCL2-03      ccttcatcgtcgccttcgtgttgctgttatacatgatatcgcctcttatt
                        * *                     ***   * *  *****          

A0A4D6FTA2_BCL2-05      -gccataaactctccaaac----agggctacgtgtgggggtttgacgatg
A0A4D6FTA2_BCL2-01      agtcccaaacctttgaagctgaacgggtcccacgtcgtggtgacaggagg
A0A4D6FTA2_BCL2-04      agtcccaaacctttgaagctgaacgggtcccacgtcgtggtgacaggagg
A0A4D6FTA2_BCL2-02      agtcccaaacctttgaagctgaacgggtcccacgtcgtggtgacaggagg
A0A4D6FTA2_BCL2-03      agtcccaaacctttgaagctgaacgggtcccacgtcgtggtgacaggagg
                         * *  ****  *  ** *     ***   *  ** * ***   * ** *

A0A4D6FTA2_BCL2-05      tcc----gggatgaaga-----------------tgctgctaataacggg
A0A4D6FTA2_BCL2-01      ctcaagtgggattgggaagtgcattgcaatagagtgctacagacaaggag
A0A4D6FTA2_BCL2-04      ctcaagtgggattgggaagtgcattgcaatagagtgctacagacaaggag
A0A4D6FTA2_BCL2-02      ctcaagtgggattgggaagtgcattgcaatagagtgctacagacaaggag
A0A4D6FTA2_BCL2-03      ctcaagtgggattgggaagtgcattgcaatagagtgctacagacaaggag
                          *    *****   **                 **** *  * ** * *

A0A4D6FTA2_BCL2-05      tcaatagttgctcctccaccgactttagtccgccggtgccgtgaggcca-
A0A4D6FTA2_BCL2-01      --------cgttcatc-----actttggtggcccggg---atgaggctaa
A0A4D6FTA2_BCL2-04      --------cgttcatc-----actttggtggcccggg---atg-------
A0A4D6FTA2_BCL2-02      --------cgttcatc-----actttggtggcccggg---atgaggctaa
A0A4D6FTA2_BCL2-03      --------cgttcatc-----actttggtggcccggg---atgaggctaa
                                 * ** **     ***** **   ****     **       

A0A4D6FTA2_BCL2-05      ---gcaccgggc-----------------------------ctgaca--c
A0A4D6FTA2_BCL2-01      attgcttcaagcaaagaaagaggtggagaagtttgccatcaatgacaagc
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      attgcttcaagcaaagaaagaggtggagaagtttgccatcaatgacaagc
A0A4D6FTA2_BCL2-03      attgcttcaagcaaagaaagaggtggagaagtttgccatcaatgacaagc

A0A4D6FTA2_BCL2-05      cgagagcatcccccacctctgcaaacgtctcccccagtccgacccgcacg
A0A4D6FTA2_BCL2-01      aggtggtgttgtgcatatcggtcgatgtttccagtgattatagccaggtg
A0A4D6FTA2_BCL2-04      aggtggtgttgtgcatatcggtcgatgtttccagtgattatagccaggtg
A0A4D6FTA2_BCL2-02      aggtggtgttgtgcatatcggtcgatgtttccagtgattatagccaggtg
A0A4D6FTA2_BCL2-03      aggtggtgttgtgcatatcggtcgatgtttccagtgattatagccaggtg
                         *   *  *    **  ** *   * ** ***     *   * **    *

A0A4D6FTA2_BCL2-05      ccgccatccacagagtcctgcgcgaggctggagatgaac-----------
A0A4D6FTA2_BCL2-01      --------gaaagtgtgataaaacaggctcaagagaagctgggccctgtt
A0A4D6FTA2_BCL2-04      --------gaaagtgtgataaaacaggctcaagagaagctgggccctgtt
A0A4D6FTA2_BCL2-02      --------gaaagtgtgataaaacaggctcaagagaagctgggccctgtt
A0A4D6FTA2_BCL2-03      --------gaaagtgtgataaaacaggctcaagagaagctgggccctgtt
                                 * ** **  *     *****  ***  * *           

A0A4D6FTA2_BCL2-05      ------ttgaaagactgtaccag---ccggacttcacggagatgtcacgg
A0A4D6FTA2_BCL2-01      gacatgttggtgaactgtgctggaacttcaatttctggaaagtttgagga
A0A4D6FTA2_BCL2-04      gacatgttggtgaactgtgctggaacttcaatttctggaaagtttgagga
A0A4D6FTA2_BCL2-02      gacatgttggtgaactgtgctggaacttcaatttctggaaagtttgagga
A0A4D6FTA2_BCL2-03      gacatgttggtgaactgtgctggaacttcaatttctggaaagtttgagga
                              ***    ***** *  *       * ***  * *  * * * * 

A0A4D6FTA2_BCL2-05      ca--gctgtatctcacctccaccacggcgcagaggagattcgccgaggtg
A0A4D6FTA2_BCL2-01      catggatgtagaccgctttaaaaaaatgatggaggtgaactacctgggca
A0A4D6FTA2_BCL2-04      catggatgtagaccgctttaaa----------------------------
A0A4D6FTA2_BCL2-02      catggatgtagaccgctttaaaaaaatgatggaggtgaactacctgggca
A0A4D6FTA2_BCL2-03      catggatgtagaccgctttaaaaaaatgatggaggtgaactacctgggca
                        **  * ****   * * *  *                             

A0A4D6FTA2_BCL2-05      at---------agacgaactgtt-------ccgggacggggtgaactg-g
A0A4D6FTA2_BCL2-01      gcgtttacccgacacgggccgtcataaccaccatgaaggagcgaagaatg
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      gcgtttacccgacacgggccgtcataaccaccatgaaggagcgaagaatg
A0A4D6FTA2_BCL2-03      gcgtttacccgacacgggccgtcataaccaccatgaaggagcgaagaatg

A0A4D6FTA2_BCL2-05      ggccggatta---tcgctttcttcga------------------gttcgg
A0A4D6FTA2_BCL2-01      ggccgtatcatgtttgtgtcctcccaagcaggccagatcggcctgtttgg
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      ggccgtatcatgtttgtgtcctcccaagcaggccagatcggcctgtttgg
A0A4D6FTA2_BCL2-03      ggccgtatcatgtttgtgtcctcccaagcaggccagatcggcctgtttgg

A0A4D6FTA2_BCL2-05      gggcacggtgt-------------gcgtggagtgcgtggccaaggaggag
A0A4D6FTA2_BCL2-01      atacactgcatactccccatccaagttcgccctgcgtggcttagcaga--
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      atacactgcatactccccatccaagttcgccctgcgtggcttagcaga--
A0A4D6FTA2_BCL2-03      atacactgcatactccccatccaagttcgccctgcgtggcttagcaga--

A0A4D6FTA2_BCL2-05      atgacaccgcaggtgg------------acaacatcg-------------
A0A4D6FTA2_BCL2-01      --gtcgctgcagatggagataaagccatacaatatctatgtgactgtggc
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      --gtcgctgcagatggagataaagccatacaatatctatgtgactgtggc
A0A4D6FTA2_BCL2-03      --gtcgctgcagatggagataaagccatacaatatctatgtgactgtggc

A0A4D6FTA2_BCL2-05      ------------------------cggagtggatgacgg-----------
A0A4D6FTA2_BCL2-01      ctacccccctgacactgacactccaggattggctgaagaaaataaaacaa
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      ctacccccctgacactgacactccaggattggctgaagaaaataaaacaa
A0A4D6FTA2_BCL2-03      ctacccccctgacactgacactccaggattggctgaagaaaataaaacaa

A0A4D6FTA2_BCL2-05      -------agtatttaaatggacctctg-aacagctgga------------
A0A4D6FTA2_BCL2-01      agcctctagagaccaaattaatctctgaaaccgctggagtttgccaacca
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      agcctctagagaccaaattaatctctgaaaccgctggagtttgccaacca
A0A4D6FTA2_BCL2-03      agcctctagagaccaaattaatctctgaaaccgctggagtttgccaacca

A0A4D6FTA2_BCL2-05      ---------tacaagataacgg---gggatg-------------------
A0A4D6FTA2_BCL2-01      gaccaagttgccaaaatcattgttcgggatgcagtgcaggggaactttaa
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      gaccaagttgccaaaatcattgttcgggatgcagtgcaggggaactttaa
A0A4D6FTA2_BCL2-03      gaccaagttgccaaaatcattgttcgggatgca-----------------

A0A4D6FTA2_BCL2-05      --------------------------------------------------
A0A4D6FTA2_BCL2-01      cagctctgtgggacctgatggttacatgctatcagccctcacctgtggaa
A0A4D6FTA2_BCL2-04      --------------------------------------------------
A0A4D6FTA2_BCL2-02      cagctctgtgggacctgatggttacatgctatcagccctcacctgtggaa
A0A4D6FTA2_BCL2-03      --------------------------------------------------

A0A4D6FTA2_BCL2-05      -------------------------------------ggatgcctttgta
A0A4D6FTA2_BCL2-01      tgtcacccgtcacctccatcacagaaggtctccagcaggatgcctttgta
A0A4D6FTA2_BCL2-04      --------------------------------------attgttaccatg
A0A4D6FTA2_BCL2-02      tgtcacccgtcacctccatcacagaaggtctccagcagattgttaccatg
A0A4D6FTA2_BCL2-03      --------------------------------------attgttaccatg
                                                                **      * 

A0A4D6FTA2_BCL2-05      gagctgtatgacagacagagggactccgtcttcagttgctcctggccctc
A0A4D6FTA2_BCL2-01      gagctgtatgacagacagagggactccgtcttcagttgctcctggccctc
A0A4D6FTA2_BCL2-04      ggattattt--cggac-------catcgccctc--ttctacctgg---gt
A0A4D6FTA2_BCL2-02      ggattattt--cggac-------catcgccctc--ttctacctgg---gt
A0A4D6FTA2_BCL2-03      ggattattt--cggac-------catcgccctc--ttctacctgg---gt
                        *   * * *  * ***       *  ** * **  **   *****     

A0A4D6FTA2_BCL2-05      cattaagacggtcttcggtatggctgc---gctcggggcagccagcctca
A0A4D6FTA2_BCL2-01      cattaagacggtcttcggtatggctgc---gctcggggcagccagcctca
A0A4D6FTA2_BCL2-04      agttttgacagcattgtgcgtcgctgcatgattcaaagggagcagtc---
A0A4D6FTA2_BCL2-02      agttttgacagcattgtgcgtcgctgcatgattcaaagggagcagtc---
A0A4D6FTA2_BCL2-03      agttttgacagcattgtgcgtcgctgcatgattcaaagggagcagtc---
                          **  *** *  **  *  * *****     **   *    *** *   

A0A4D6FTA2_BCL2-05      ccatcggggcataccttac---acagaagtga
A0A4D6FTA2_BCL2-01      ccatcggggcataccttac---acagaagtga
A0A4D6FTA2_BCL2-04      ------gaaagcagctgacaagacag-agtaa
A0A4D6FTA2_BCL2-02      ------gaaagcagctgacaagacag-agtaa
A0A4D6FTA2_BCL2-03      ------gaaagcagctgacaagacag-agtaa
                              *     * ** **   **** *** *

© 1998-2021Legal notice