Dataset for CDS BCL2L2 of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G5ASL3_BCL2L2-01      atggcgaccccagcctcagcaccagacacacgggctctggtggctgactt
G5ASL3_BCL2L2-02      atggcgaccccagcctcagcaccagacacacgggctctggtggctgactt

G5ASL3_BCL2L2-01      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
G5ASL3_BCL2L2-02      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg

G5ASL3_BCL2L2-01      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
G5ASL3_BCL2L2-02      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga

G5ASL3_BCL2L2-01      gatgagttcgagacccgcttccgtcgcaccttctctgatctggctgctca
G5ASL3_BCL2L2-02      gatgagttcgagacccgcttccgtcgcaccttctctgatctggctgctca

G5ASL3_BCL2L2-01      gctgcatgtgacccctggctcagcccagcaacgcttcacccaggtctccg
G5ASL3_BCL2L2-02      gctgcatgtgacccctggctcagcccagcaacgcttcacccaggtctccg

G5ASL3_BCL2L2-01      acgaacttttccaagggggcccaaactggggccgtcttgtggccttcttt
G5ASL3_BCL2L2-02      acgaacttttccaagggggcccaaactggggccgtcttgtggccttcttt

G5ASL3_BCL2L2-01      gtctttggggctgccctatgtgctgagagtgtcaacaaagagatggaacc
G5ASL3_BCL2L2-02      gtctttggggctgccctatgtgctgagagtgtcaacaaagagatggaacc

G5ASL3_BCL2L2-01      actggtgggccaagtgcaggagtggatggtggcttacctggagacgagac
G5ASL3_BCL2L2-02      actggtgggccaagtgcaggagtggatggtggcttacctggagacgagac

G5ASL3_BCL2L2-01      tggccgactggatccacagcagtgggggctgggcggagttcacagctcta
G5ASL3_BCL2L2-02      tggccgactggatccacagcagtgggggctgg------------------

G5ASL3_BCL2L2-01      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
G5ASL3_BCL2L2-02      -----------------------------------------------ctg

G5ASL3_BCL2L2-01      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg
G5ASL3_BCL2L2-02      atctccagggggaa-------gatgggggctctg--attggcggctgggg
                        *  *** * * *       ** ******  **  * *** ***   **

G5ASL3_BCL2L2-01      taactgtaggggccttttttgctagcaagtga
G5ASL3_BCL2L2-02      cagctg-------------tgctgggaaggag
                       * ***             **** * ***   

© 1998-2022Legal notice