Dataset for CDS BCL-2-like of organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C4PQL1_BCL2A1-      atg-----------------------------------------------
A0A8C4L2X1_BCL2L1-      atgtct--------------------------------------------
A0A8C4L1K6_BCL2-01      atg-------------------------gcgcacgc-----------tgg
A0A8C4L244_MCL1-01      atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgg
A0A8C4LWK5_BCL2L2-      atg-------------------------gcgaccccagcctcagcc----

A0A8C4PQL1_BCL2A1-      ------------------------------------ac------------
A0A8C4L2X1_BCL2L1-      -----cagagcaac-----cgggagctggtggttg-actttct-------
A0A8C4L1K6_BCL2-01      gagaacagggtatgataaccgggagatagtgatga-agtacat-------
A0A8C4L244_MCL1-01      gggggccgggttgg-----cggccggcggcggcggcgcctcgtcgccggg
A0A8C4LWK5_BCL2L2-      -----ccagacaca-----cgggctctagtggcag-actttgt-------

A0A8C4PQL1_BCL2A1-      ----cgactgtgagttt-----------------------------ggat
A0A8C4L2X1_BCL2L1-      ----ctcctacaagctt--------------------tcccagaaaggat
A0A8C4L1K6_BCL2-01      ----ccactataagctg--------------------tcgcagaggggct
A0A8C4L244_MCL1-01      agggcggcttttggctgcggggaaggaggccacggcccggcgagagggag
A0A8C4LWK5_BCL2L2-      ----aggctataagctg--------------------aggcagaagggtt
                               **    * *                              **  

A0A8C4PQL1_BCL2A1-      atattcac----------------------atgct--------ggc-cca
A0A8C4L2X1_BCL2L1-      acaactggagtcagtttagtgacgtggaagagaacagaactgaggcccca
A0A8C4L1K6_BCL2-01      acgagtgg---------------------gatgcc--------ggagacg
A0A8C4L244_MCL1-01      ggggaggg---------------------gaggcc--------ggcgcgg
A0A8C4LWK5_BCL2L2-      atgtttgt---------------------ggagct--------ggccccg

A0A8C4PQL1_BCL2A1-      ggactacctgaa--------------------------------------
A0A8C4L2X1_BCL2L1-      gaagggactgaatcagagatggagacccccag-------------tgcca
A0A8C4L1K6_BCL2-01      cgg-gcgccgcgcccctgggggccacccccgtgccgggcatcttctcctc
A0A8C4L244_MCL1-01      tgattggcggaagcgccggcgggagcccccagac----------------
A0A8C4LWK5_BCL2L2-      gggagggcccagccgctgac------------------------------

A0A8C4PQL1_BCL2A1-      ------------------------------gtacgtcctgcagataccac
A0A8C4L2X1_BCL2L1-      tcaatggcaacccatcctggcacctggcg-gacagccccacggggaa---
A0A8C4L1K6_BCL2-01      ccagcccgggcgcacccccgcgcccgccaggacctccccgctgctacccc
A0A8C4L244_MCL1-01      ------------caccctcgcgcc------ggactccctgagggtcgcgc
A0A8C4LWK5_BCL2L2-      --------------ccactgcacc------aag--ccatgcgggcagc--
                                                            *     *       

A0A8C4PQL1_BCL2A1-      aacc----------------------tggatctggtccaagcaaaa-cat
A0A8C4L2X1_BCL2L1-      -------------tggagccac----tggccacagcagcagcttggatgc
A0A8C4L1K6_BCL2-01      cggccgcccccgccggcgccgc----gggacctgccctcagccctg-tgc
A0A8C4L244_MCL1-01      ggccctcccccattggcgccga----gggccccgacgtcacc---g-cgc
A0A8C4LWK5_BCL2L2-      -------------tggagatgagtttgagacccgcttccggc---g-cac
                                                    *            *        

A0A8C4PQL1_BCL2A1-      cc----agagtgttacaagacattgctttctcagttcaaaatgaagtaga
A0A8C4L2X1_BCL2L1-      ccgggaagtgatccccatggcagca---------gtgaagcaagcgctga
A0A8C4L1K6_BCL2-01      ca---------cctgtg-----------------gtccacctgaccctgc
A0A8C4L244_MCL1-01      cc---------ccctccaggctgcgtttcttcgcgcccacccg---ctgc
A0A8C4LWK5_BCL2L2-      ct---------tctctgatctggcg---------gctca---g---ctgc
                        *                                     *         * 

A0A8C4PQL1_BCL2A1-      gaagaatt-----------tgaaaccatgcttggacaattttcatgttgt
A0A8C4L2X1_BCL2L1-      gggaggca------ggggatgagtttgaactgaggtaccggcgggcattc
A0A8C4L1K6_BCL2-01      gccaggcc------ggcgatgacttctcccgtcgctaccgccgcgacttt
A0A8C4L244_MCL1-01      gcgtcgccgcctgaggggatggaagccccggccgccgacgccatcatgtc
A0A8C4LWK5_BCL2L2-      atgtgacccc------------gggctcagcccagcaacgct------tc

A0A8C4PQL1_BCL2A1-      gtccatagatg------------------------------ctgccagaa
A0A8C4L2X1_BCL2L1-      agc----gacctgacatcccagctccacatcaccccagggacagcatatc
A0A8C4L1K6_BCL2-01      gcc----gagatgtccagccagctgcacctgacgcctttcaccgcgaggg
A0A8C4L244_MCL1-01      gcccgaggaggagctggacgggtacgagccggagcctct---cgggaagc
A0A8C4LWK5_BCL2L2-      acccag--------------------------------------------

A0A8C4PQL1_BCL2A1-      caatattcaatcaagtgatggaaaagcaatttgaagacggcatcattaac
A0A8C4L2X1_BCL2L1-      agagctttgagcaggtagtgaatgaactcttccgggatggggtg---aac
A0A8C4L1K6_BCL2-01      gacgctttgccacggtagtggaggagctcttcagggatggggtg---aac
A0A8C4L244_MCL1-01      ggccggctgtcctgcccttgctggagtttgtccggga-gg--cc---agc
A0A8C4LWK5_BCL2L2-      -------------gtctctgacgaactcttccaaggg-ggcccc---aac
                                          **    *          *  **       * *

A0A8C4PQL1_BCL2A1-      tggggaagaattatgacc--atatttgcatttgaaggtattctcatcaag
A0A8C4L2X1_BCL2L1-      tggggtcgcattgtggcc--tttttctccttcggtggggc----------
A0A8C4L1K6_BCL2-01      tgggggaggattgtggcc--ttctttgagttcggtggggt----------
A0A8C4L244_MCL1-01      agtggcccctgcacggacggctcgctcccctcgacgccgcccccagcaga
A0A8C4LWK5_BCL2L2-      tggggccgccttgtggcc--ttctttgtctttggagccgc----------
                         * **         *  *   *        * *  *              

A0A8C4PQL1_BCL2A1-      aaacttctaccagagcgaattgccccagatgtggatact-----------
A0A8C4L2X1_BCL2L1-      ---------------actgtg--------cgtggaaagc-----------
A0A8C4L1K6_BCL2-01      ---------------catgtg--------tgtggagagc-----------
A0A8C4L244_MCL1-01      ggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgtt
A0A8C4LWK5_BCL2L2-      ---------------gctgtg--------tgctgagagt-----------
                                           *          *  *                

A0A8C4PQL1_BCL2A1-      -----------------------tacaaggagatttcttactt-------
A0A8C4L2X1_BCL2L1-      --------------------gtagacaaggagatgcaggtatt-ggtgag
A0A8C4L1K6_BCL2-01      --------------------gtcaaccgggagatgtcgcccct-ggtgga
A0A8C4L244_MCL1-01      accttcgggaacaggctaccggcgccaaggacacgaagccaatgggcggg
A0A8C4LWK5_BCL2L2-      --------------------gtcaacaaggagatggagccact-tgtggg
                                                 *  *** *         *       

A0A8C4PQL1_BCL2A1-      -----tgttgctgagttcataacgaaaaacacagga--------------
A0A8C4L2X1_BCL2L1-      tc--ggatcgcaacctggatggccacttacctgaatgac---cacctaga
A0A8C4L1K6_BCL2-01      --caacatcgccctgtggatgactgaatacctgaa---ccggcacctgca
A0A8C4L244_MCL1-01      tctggggccgccagccggaaggcg------ttagagaccctgcggcgggt
A0A8C4LWK5_BCL2L2-      acaagtgcag--gagtggatggtggcctacctggagact---cggctggc
                                 *        *                               

A0A8C4PQL1_BCL2A1-      ----gaatggataaggcaaaat----------------------------
A0A8C4L2X1_BCL2L1-      g---ccttggatccaagagaac----------------------------
A0A8C4L1K6_BCL2-01      c---acctggatccaggataac----------------------------
A0A8C4L244_MCL1-01      cggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttc
A0A8C4LWK5_BCL2L2-      c---gactggatccacagcagt----------------------------
                                *  *       *                              

A0A8C4PQL1_BCL2A1-      ggaggctgggaa--------------------------------------
A0A8C4L2X1_BCL2L1-      ggcggctgggac--------------------------------------
A0A8C4L1K6_BCL2-01      ggaggctgggac--------------------------------------
A0A8C4L244_MCL1-01      ggaaactggatatcaaaaatgaagacgatgtcaaatctttgtctcgagtg
A0A8C4LWK5_BCL2L2-      ggaggctgggcg--------------gagttcacagctctata-------
                        **   ****                                         

A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A8C4L244_MCL1-01      atggcccacgttttcagtgacggagtgacaaactggggcaggattgtgac
A0A8C4LWK5_BCL2L2-      --------------cggggacggggc-----cctggaggaggcgcg----

A0A8C4PQL1_BCL2A1-      -------------aatggctttgtaa------------------------
A0A8C4L2X1_BCL2L1-      ----------------acctttgtgg------------------------
A0A8C4L1K6_BCL2-01      ----------------gcctttgtgg------------------------
A0A8C4L244_MCL1-01      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaacc
A0A8C4LWK5_BCL2L2-      ----------------gcgtctgcgg-----------------------g
                                           * **                           

A0A8C4PQL1_BCL2A1-      --agaagttt-------------------gaaccca--------------
A0A8C4L2X1_BCL2L1-      -----aactctac----------------gggaacaacgcggcagccgaa
A0A8C4L1K6_BCL2-01      -----aactgtac----------------ggcccca--------------
A0A8C4L244_MCL1-01      aagaaagctgcatcgaaccattagcagaaagcatcacagatgtcctcgta
A0A8C4LWK5_BCL2L2-      aggggaactg-------------------ggcctca-----------gtg
                             *  *                         **              

A0A8C4PQL1_BCL2A1-      ---------------------------------------aatctggctg-
A0A8C4L2X1_BCL2L1-      agcc----------------------------------ggaagggccagg
A0A8C4L1K6_BCL2-01      --------------------------------------gcatgcggccgc
A0A8C4L244_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A8C4LWK5_BCL2L2-      aggaca--------------------------gtgctgacaggggcc---
                                                                *   *     

A0A8C4PQL1_BCL2A1-      ------------------------------------------------gc
A0A8C4L2X1_BCL2L1-      agcgc---ttcaaccgctggttcctgacg--ggcat--------------
A0A8C4L1K6_BCL2-01      tgtttgatttctcctggctgtctctgaaggcgctgctcag--------tc
A0A8C4L244_MCL1-01      ggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgc
A0A8C4LWK5_BCL2L2-      -----------------------------gtggcattggg----------

A0A8C4PQL1_BCL2A1-      tgacttttctggaagttactggaaagatgtgtgaaatacttttcctgaa-
A0A8C4L2X1_BCL2L1-      -gactgtggc---tggtgtggttctgctgggct-----cgctcttca---
A0A8C4L1K6_BCL2-01      tggccctggtgggagcttgtatcaccctgggtg-----cctatctgg---
A0A8C4L244_MCL1-01      tggcttttgc---aggtgttgctggagtaggcg-----ctggtttggcat
A0A8C4LWK5_BCL2L2-      -ggccctggt---aact---------gtagggg-----ccttttttg---
                         * *  *         *          *  *       *           

A0A8C4PQL1_BCL2A1-      --gcaatactattga-
A0A8C4L2X1_BCL2L1-      --gtcgga--agtga-
A0A8C4L1K6_BCL2-01      --gccaca--agtga-
A0A8C4L244_MCL1-01      atctaata--agatag
A0A8C4LWK5_BCL2L2-      --ctagca--agtga-
                               *  *   * 

© 1998-2023Legal notice