Dataset for CDS BCL-2-like of organism Dipodomys ordii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1S3EPX7_BCL2L1-      atgtctcagagcaaccgtgagctggtggttgactt---tctctcctacaa
A0A1S3F3I1_MCL1-01      atgtttggcctcagaagaaacgcggtaatcggactcaacttctactgtgg
A0A1S3FYD8_BCL2L2-      atg-------------------------gcgaccccagcctcagccccag
                        ***                           *         **  *     

A0A1S3EPX7_BCL2L1-      gctttcccagaaaggatacagc--tggagtcagtttagcgatgtggaaga
A0A1S3F3I1_MCL1-01      gggcgccgggctgggcgccggcagcggggccgccgccgcgccgggagggc
A0A1S3FYD8_BCL2L2-      acacac------gggctctggt-----ggctgactttgta----------
                             *       **     *       *        *            

A0A1S3EPX7_BCL2L1-      gagca-ggactgaggacccagaaggaactgaatcggagatggagaccccc
A0A1S3F3I1_MCL1-01      ggctcttgacggcgg----aggagg-------------------------
A0A1S3FYD8_BCL2L2-      ggctataaactgagg---cagaagg-------------------------
                        *       ** * **    ** ***                         

A0A1S3EPX7_BCL2L1-      agtgctatcaatggcaacccatcctggcacctggcggacagccccgcggt
A0A1S3F3I1_MCL1-01      -----------------------ccagtgcccggcgggaggcggggggag
A0A1S3FYD8_BCL2L2-      -----------------------gttatgtctg-----------------
                                                      * *                 

A0A1S3EPX7_BCL2L1-      ggtgaatggagccacgggtcacagcagcagttcggaagcccgggaagtga
A0A1S3F3I1_MCL1-01      gggaagccggcgcggggattg----------gcggaagcgccgg-cgcga
A0A1S3FYD8_BCL2L2-      -------------------tg----------gagcgggccctgg-ggagg
                                                         *   ** * **  * * 

A0A1S3EPX7_BCL2L1-      ttcccatggcagct---gtgaagcaagcgctgagggaggc----------
A0A1S3F3I1_MCL1-01      gcccctcgaccaccctggcgccggacgcccggagggtcgcgcgtcccgcg
A0A1S3FYD8_BCL2L2-      gcccagcagctgacccactgcatcaagccatgcgggcagc----------
                          **     *         *    * **   * ***  **          

A0A1S3EPX7_BCL2L1-      -----aggcgatgagtt------------tgaactgc-------------
A0A1S3F3I1_MCL1-01      cccattggcgccgaggtccccgacgtcaccgggaccccaactaagcgggt
A0A1S3FYD8_BCL2L2-      -----tggagatgaatt------------tgagaccc-------------
                              ** *  **  *             *     *             

A0A1S3EPX7_BCL2L1-      --ggtatcgacgggcattcagtgacc---------------tgacatcc-
A0A1S3F3I1_MCL1-01      gttcttcgcgcccacccaccgtgcgccgacgccggacgagatggaagccg
A0A1S3FYD8_BCL2L2-      --gcttccggcgcaccttctctgatc---------------tggcagct-
                            *     *   *   *  **  *               **  * *  

A0A1S3EPX7_BCL2L1-      cagctc----------catattaccccggggacagcatatcagagctttg
A0A1S3F3I1_MCL1-01      cggccgccggcgccatcatgtcgcccgaagaggagctggacggctacgaa
A0A1S3FYD8_BCL2L2-      cagctg----------catgtgaccccaggctcagcccagcaacgcttca
                        * **            *** *  ***   *   ***    *         

A0A1S3EPX7_BCL2L1-      agcaggtagtgaacgaa---------------------------------
A0A1S3F3I1_MCL1-01      cccgagcccctggggaagaggccggccgtcctgcccctgctggagctggt
A0A1S3FYD8_BCL2L2-      cccaggtctctgatgaa---------------------------------
                          *  *        ***                                 

A0A1S3EPX7_BCL2L1-      ---------------------------------------ctcttccggga
A0A1S3F3I1_MCL1-01      cggggaagccagtaagagctcgcgcacggacggctcgctcccttccacgc
A0A1S3FYD8_BCL2L2-      ---------------------------------------cttttccaagg
                                                               *  ****  * 

A0A1S3EPX7_BCL2L1-      tggggtaaactggg---------gtcgaattgt---ggcctttttct---
A0A1S3F3I1_MCL1-01      cgcctccagcggaggaggaggacgacgagttgtaccggcagtcgctggag
A0A1S3FYD8_BCL2L2-      aggccccaactggg---------gccgtcttgt---ggccttctttg---
                         *     * * * *         * **  ****   ***  *        

A0A1S3EPX7_BCL2L1-      --ccttcggcggggcactgtgtgtggaa--agcgtagacaaggagatgca
A0A1S3F3I1_MCL1-01      attatctgtcgctaccttagggagcaagccacgggcgccaaggacgccaa
A0A1S3FYD8_BCL2L2-      --tctttggggctgccctgtgtgccgag--agtgtcaacaaagaaatgga
                            *  *  *   *  *  *     *   *  *    *** **     *

A0A1S3EPX7_BCL2L1-      ggtatt-ggtgagtcggat--cgcaagttggatggccacttacctgaatg
A0A1S3F3I1_MCL1-01      gccgctgggtggggccggcgcggccagcaggaaggcg------ctgga-g
A0A1S3FYD8_BCL2L2-      accact-ggtgggacaagtgcag--gagtggatggtggcctacctgga-g
                             * **** * *       *      *** **        *** * *

A0A1S3EPX7_BCL2L1-      acc--acctagagcc-----ttggatccaggagca---------------
A0A1S3F3I1_MCL1-01      accctgcggcgggtcggggacggggtgca-gcgcaaccacgagacggcct
A0A1S3FYD8_BCL2L2-      ac---gcgcctggcc---gactggatcca-cagcag--------------
                        **    *     * *       ** * **   ***               

A0A1S3EPX7_BCL2L1-      --------------cggcggctggg----------------------aca
A0A1S3F3I1_MCL1-01      tccaaggcatgcttcggaaactggacatcaaaaacgaagacgacgtcaaa
A0A1S3FYD8_BCL2L2-      --------------tgggggctgggcg--------------gagttcaca
                                       **   ****                       * *

A0A1S3EPX7_BCL2L1-      cttttgtg-------------gaactctacgggaacaatgcagcagctga
A0A1S3F3I1_MCL1-01      tctttatctcgagtgatgatccatgttttcagtgacggcgtaacaaactg
A0A1S3FYD8_BCL2L2-      gctctata---------------------cggggacggggc-----cctg
                          * * *                      * *  **   *          

A0A1S3EPX7_BCL2L1-      gagtcgg--------------------aagggc-----------------
A0A1S3F3I1_MCL1-01      gggtaggattgtgactctaatttctttcggtgcctttgtggccaaacact
A0A1S3FYD8_BCL2L2-      gaggagg--------------------cgcggcgtctgcgg---------
                        * *  **                        **                 

A0A1S3EPX7_BCL2L1-      --------------caggagcgcttca-----------------------
A0A1S3F3I1_MCL1-01      tgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagtatc
A0A1S3FYD8_BCL2L2-      --------------gaggggaactg-------------------ggcatc
                                       * *    **                          

A0A1S3EPX7_BCL2L1-      accgctggttcctgacgggca---------tgac-----------cgtgg
A0A1S3F3I1_MCL1-01      acagatgttctcgtaaggacaaaacgggactggctagtcaaacaaagagg
A0A1S3FYD8_BCL2L2-      a-----------gtgaggaca-----gtgctgac-----------ggggg
                        *               ** **         ** *            * **

A0A1S3EPX7_BCL2L1-      ccggtgtg------------------------------------------
A0A1S3F3I1_MCL1-01      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggcagca
A0A1S3FYD8_BCL2L2-      ccgtg---------------------------------------------
                        * *                                               

A0A1S3EPX7_BCL2L1-      --------gttctgctgg--------------------------gctcgc
A0A1S3F3I1_MCL1-01      tcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggt
A0A1S3FYD8_BCL2L2-      --------gcactgggggccctggtaact---------gtaggggccttt
                                *  ***  **                          **    

A0A1S3EPX7_BCL2L1-      tcttcag----tcggaaatga
A0A1S3F3I1_MCL1-01      ttggcatatctcataagatag
A0A1S3FYD8_BCL2L2-      tttgc------tagcaagtga
                        *   *          *  *  

© 1998-2020Legal notice