Dataset for CDS BCL-2 of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A3KNH9_BCL2-01      atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaa
Q564A4_BCL2-01      atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaa
                    ************************************************************

A3KNH9_BCL2-01      ctttcaaagcgaggatatgtgtggaaatgtcagtcctctgctgaggaagatgacaccttc
Q564A4_BCL2-01      ctttcaaagcgaggatatgtgtggaaatgtcagtcctctgctgaggaagatgacaccttc
                    ************************************************************

A3KNH9_BCL2-01      aataaagcagtggaggaatcctctccaaactctgacaggaggcttcaggctccctcagcc
Q564A4_BCL2-01      aataaagcagtggaggaatcctctccaaactctgacaggaggcttcaggctccctcagcc
                    ************************************************************

A3KNH9_BCL2-01      ggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
Q564A4_BCL2-01      ggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
                    ************************************************************

A3KNH9_BCL2-01      aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaa
Q564A4_BCL2-01      aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaa
                    ************************************************************

A3KNH9_BCL2-01      tttgaggaaatgtcccaacaaatggtgttcaacccaaattctgcgcaacgcagctttcta
Q564A4_BCL2-01      tttgaggaaatgtcccaacaaatggtgttcaacccaaattctgcgcaacgcagctttcta
                    ************************************************************

A3KNH9_BCL2-01      accgtggccgaagagctctttagagacggagtgaactgggggcggatcattgcattcttc
Q564A4_BCL2-01      accgtggccgaagagctctttagagacggagtgaactgggggcggatcattgcattcttc
                    ************************************************************

A3KNH9_BCL2-01      gagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
Q564A4_BCL2-01      gagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
                    ************************************************************

A3KNH9_BCL2-01      aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaa
Q564A4_BCL2-01      aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaa
                    ************************************************************

A3KNH9_BCL2-01      aatggaggttgggatgccttcgtggagatgtacggtcagcagagagactctgtgttccac
Q564A4_BCL2-01      aatggaggttgggatgccttcgtggagatgtacggtcagcagagagactctgtgttccac
                    ************************************************************

A3KNH9_BCL2-01      ccgttttcatacctaacaaaagtgctcggcttggcggcgctgggcttggcaggagtgacc
Q564A4_BCL2-01      ccgttttcatacctaacaaaagtgctcggcttggcggcgctgggcttggcaggagtgacc
                    ************************************************************

A3KNH9_BCL2-01      atcggagccttttttgctcagaagtga
Q564A4_BCL2-01      atcggagccttttttgctcagaagtga
                    ***************************

© 1998-2023Legal notice