Dataset for CDS BCL2A1 of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3L7HT14_BCL2A1-      atg-------------------------------------gcctgt----
A0A3L7HT14_BCL2A1-      atgattaccccttcgttgtcaagccatctttggcttagttgcctctttga
A0A3L7HT14_BCL2A1-      atgattaccccttcgttgtcaagccatctttggcttagttgcctctttga
                        ***                                     **** *    

A0A3L7HT14_BCL2A1-      ------------gcgccaatgctagtccacagaggcc-------------
A0A3L7HT14_BCL2A1-      ctggacttggcagctccagt-ctgctctgccaaggacaatgactgactgt
A0A3L7HT14_BCL2A1-      ctggacttggcagctccagt-ctgctctgccaaggacaatgactgactgt
                                    ** *** * **  **  *  *** *             

A0A3L7HT14_BCL2A1-      ----------acgccccctccct---------------------------
A0A3L7HT14_BCL2A1-      gagttcatgtacatccactcgctggctgaggactatcttcagtatgtcct
A0A3L7HT14_BCL2A1-      gagttcatgtacatccactcgctggctgaggactatcttcagtatgtcct
                                  **  ** *** **                           

A0A3L7HT14_BCL2A1-      -----------------------ccccacg--------------------
A0A3L7HT14_BCL2A1-      gaaggtacctacttttgaatctgctccaagcaaaacatccagggtgctac
A0A3L7HT14_BCL2A1-      gaaggtacctacttttgaatctgctccaagcaaaacatccagggtgctac
                                               * *** *                    

A0A3L7HT14_BCL2A1-      --------gcgtcc------------------------------------
A0A3L7HT14_BCL2A1-      aaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaacta
A0A3L7HT14_BCL2A1-      aaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaacta
                                ** ***                                    

A0A3L7HT14_BCL2A1-      --------------------gagggcgatgggcgtggccggggcggtact
A0A3L7HT14_BCL2A1-      tacttggatgattttgatgtgagatccatcgacactgccagaacaatatt
A0A3L7HT14_BCL2A1-      tacttggatgattttgatgtgagatccatcgacactgccagaacaatatt
                                            ***  * ** * *   *** *  *  ** *

A0A3L7HT14_BCL2A1-      t-gccacgtgatggcggcgg---tggcagcaagcagcgccaagcggagcc
A0A3L7HT14_BCL2A1-      caatcaagtgatggaaaaagaatttgaagatggcatcattaactgggg--
A0A3L7HT14_BCL2A1-      caatcaagtgatggaaaaagaatttgaagatggcatcattaactgggg--
                            ** *******     *   * * **   *** *   **  ** *  

A0A3L7HT14_BCL2A1-      tgcgggccgag-ctgaagcagcgtttgcgggcctt---------------
A0A3L7HT14_BCL2A1-      -gaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaactt
A0A3L7HT14_BCL2A1-      -gaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaactt
                         * **   * * *** *   ** **** ***  **               

A0A3L7HT14_BCL2A1-      ----gagcgcgga--ggaacggctgcgg------------cagtctc---
A0A3L7HT14_BCL2A1-      gcacaagagcagattggcttggatgtgggtgcttacaagcaagtttccaa
A0A3L7HT14_BCL2A1-      gcacaagagcagattggcttggatgtgggtgcttacaagcaagtttccaa
                             ** ** **  **   ** ** **             *** **   

A0A3L7HT14_BCL2A1-      -----------acctcctcacg------------------------caga
A0A3L7HT14_BCL2A1-      ttttgtggctgaattcataatgaataacacagcagagtggatacgtcaga
A0A3L7HT14_BCL2A1-      ttttgtggctgaattcataatgaataacacagcagagtggatacgtcaga
                                   *  ** * * *                        ****

A0A3L7HT14_BCL2A1-      a---------ggtgattgctcacagtcagtatcaaaattccaaaagaatt
A0A3L7HT14_BCL2A1-      atggaggctgggtgattgctcacagtcagtatcaaaattccaaaagaatt
A0A3L7HT14_BCL2A1-      atggaggctggg--------------------------------------
                        *         **                                      

A0A3L7HT14_BCL2A1-      tccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaa
A0A3L7HT14_BCL2A1-      tccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaa
A0A3L7HT14_BCL2A1-      -------------------aagatgg------------------cttcat
                                           ******                   * *** 

A0A3L7HT14_BCL2A1-      ggacattttcaaacaaggcaaaatctgcttcatccctcggtaccggttcc
A0A3L7HT14_BCL2A1-      ggacattttcaaacaaggcaaaatctgcttcatccctcggtaccggttcc
A0A3L7HT14_BCL2A1-      gaagaagtttgaac----ctaaatctg-------gctgggtgacttttc-
                        * * *  **  ***    * *******        ** ***  *  *** 

A0A3L7HT14_BCL2A1-      agagcaatcacatggacatggtgagattagcatcacctgaagagatctct
A0A3L7HT14_BCL2A1-      agagcaatcacatggacatggtgagattagcatcacctgaagagatctct
A0A3L7HT14_BCL2A1-      ------------tggaaacgatagggcag-----atctgggaaatgctct
                                    **** * * *  *         * ***   *   ****

A0A3L7HT14_BCL2A1-      ttacttcccaa--aacatcctggaatattcatcagcccgctgagggagat
A0A3L7HT14_BCL2A1-      ttacttcccaa--aacatcctggaatattcatcagcccgctgagggagat
A0A3L7HT14_BCL2A1-      tttctcctcaagcaaca-------------------ctactg--------
                        ** ** * ***  ****                   *  ***        

A0A3L7HT14_BCL2A1-      gctcgagaggaggccttatccactggtggacttgacctcatcttcttgcc
A0A3L7HT14_BCL2A1-      gctcgagaggaggccttatccactggtggacttgacctcatcttcttgcc
A0A3L7HT14_BCL2A1-      gccagagag------------------------gaccctggctcc-----
                        **  *****                        ****    ** *     

A0A3L7HT14_BCL2A1-      aggccttgggtttgacaaagatggcaaccggctagggcggggcaagggct
A0A3L7HT14_BCL2A1-      aggccttgggtttgacaaagatggcaaccggctagggcggggcaagggct
A0A3L7HT14_BCL2A1-      ----------ttcgacaatggtgaccatcacttag---------------
                                  ** ***** * ** * * *   ***               

A0A3L7HT14_BCL2A1-      actatgacacctacttgaagcgctgtgtgcagcaccaggaagtgaagccc
A0A3L7HT14_BCL2A1-      actatgacacctacttgaagcgctgtgtgcagcaccaggaagtgaagccc
A0A3L7HT14_BCL2A1-      -----------tactt------ccatttgcaa------------------
                                   *****      *  * ****                   

A0A3L7HT14_BCL2A1-      tacaccttggctttggctttcaaagagcagatctgcccccaggtcccagt
A0A3L7HT14_BCL2A1-      tacaccttggctttggctttcaaagagcagatctgcccccaggtcccagt
A0A3L7HT14_BCL2A1-      -acaactcagc---------------------------------------
                         *** **  **                                       

A0A3L7HT14_BCL2A1-      ggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccag
A0A3L7HT14_BCL2A1-      ggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccag
A0A3L7HT14_BCL2A1-      ---------tgacagga---------------------------------
                                 ***** **                                 

A0A3L7HT14_BCL2A1-      catcttaa
A0A3L7HT14_BCL2A1-      catcttaa
A0A3L7HT14_BCL2A1-      ---cttaa

© 1998-2021Legal notice