Dataset for CDS BCL2A1 of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      atgattaccccttcgttgtcaagccatctttggcttagttgcctctttga
A0A3L7HT14_BCL2A1-      atgattaccccttcgttgtcaagccatctttggcttagttgcctctttga
G3GTB4_BCL2A1-01        --------------------------------------------------
                                                                          

A0A3L7HT14_BCL2A1-      -------------------------------------atggc---ctgtg
A0A3L7HT14_BCL2A1-      ctggacttggcagctccagtctgctctgccaaggacaatgactgactgtg
A0A3L7HT14_BCL2A1-      ctggacttggcagctccagtctgctctgccaaggacaatgactgactgtg
G3GTB4_BCL2A1-01        -------------------------------------atgactgactgtg
                                                             *** *   *****

A0A3L7HT14_BCL2A1-      cgccaatgctagtcca--------cagaggcc----------acgccc--
A0A3L7HT14_BCL2A1-      agttcatgtacatccactcgctggctgaggactatcttcagtatgtcctg
A0A3L7HT14_BCL2A1-      agttcatgtacatccactcgctggctgaggactatcttcagtatgtcctg
G3GTB4_BCL2A1-01        agttcatgtacatccactcgctggctgaggactatcttcagtatgtcctg
                         *   ***    ****        * **** *          * * **  

A0A3L7HT14_BCL2A1-      ------cctccct---------ccccacg---------------------
A0A3L7HT14_BCL2A1-      aaggtacctacttttgaatctgctccaagcaaaacatccagggtgctaca
A0A3L7HT14_BCL2A1-      aaggtacctacttttgaatctgctccaagcaaaacatccagggtgctaca
G3GTB4_BCL2A1-01        aaggtacctacttttgaatctgctccaagcaaaacatccagggtgctaca
                              *** * *         * *** *                     

A0A3L7HT14_BCL2A1-      -------gcgtcc-------------------------------------
A0A3L7HT14_BCL2A1-      aagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaactat
A0A3L7HT14_BCL2A1-      aagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaactat
G3GTB4_BCL2A1-01        aagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaactat
                               ** ***                                     

A0A3L7HT14_BCL2A1-      -------------------gagggcgatgggcgtggccggggcggtactt
A0A3L7HT14_BCL2A1-      acttggatgattttgatgtgagatccatcgacactgccagaacaatattc
A0A3L7HT14_BCL2A1-      acttggatgattttgatgtgagatccatcgacactgccagaacaatattc
G3GTB4_BCL2A1-01        acttggatgattttgatgtgagatccatcgacactgccagaacaatattc
                                           ***  * ** * *   *** *  *  ** * 

A0A3L7HT14_BCL2A1-      -gccacgtgatggcggcgg---tggcagcaagcagcgccaagcggagcct
A0A3L7HT14_BCL2A1-      aatcaagtgatggaaaaagaatttgaagatggcatcattaactgggg---
A0A3L7HT14_BCL2A1-      aatcaagtgatggaaaaagaatttgaagatggcatcattaactgggg---
G3GTB4_BCL2A1-01        aatcaagtgatggaaaaagaatttgaagatggcatcattaactgggg---
                           ** *******     *   * * **   *** *   **  ** *   

A0A3L7HT14_BCL2A1-      gcgggccgag-ctgaagcagcgtttgcgggcctt----------------
A0A3L7HT14_BCL2A1-      gaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttg
A0A3L7HT14_BCL2A1-      gaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttg
G3GTB4_BCL2A1-01        gaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttg
                        * **   * * *** *   ** **** ***  **                

A0A3L7HT14_BCL2A1-      ---gagcgcgga--ggaacggctgcgg------------cagtctc----
A0A3L7HT14_BCL2A1-      cacaagagcagattggcttggatgtgggtgcttacaagcaagtttccaat
A0A3L7HT14_BCL2A1-      cacaagagcagattggcttggatgtgggtgcttacaagcaagtttccaat
G3GTB4_BCL2A1-01        cacaagagcagattggcttggatgtgggtgcttacaagcaagtttccaat
                            ** ** **  **   ** ** **             *** **    

A0A3L7HT14_BCL2A1-      ----------acctcctcacg------------------------cagaa
A0A3L7HT14_BCL2A1-      tttgtggctgaattcataatgaataacacagcagagtggatacgtcagaa
A0A3L7HT14_BCL2A1-      tttgtggctgaattcataatgaataacacagcagagtggatacgtcagaa
G3GTB4_BCL2A1-01        tttgtggctgaattcataatgaataacacagcagagtggatacgtcagaa
                                  *  ** * * *                        *****

A0A3L7HT14_BCL2A1-      ---------ggtgattgctcacagtcagtatcaaaattccaaaagaattt
A0A3L7HT14_BCL2A1-      tggaggctgggtgattgctcacagtcagtatcaaaattccaaaagaattt
A0A3L7HT14_BCL2A1-      tggaggctggg---------------------------------------
G3GTB4_BCL2A1-01        tggaggctggg---------------------------------------
                                 **                                       

A0A3L7HT14_BCL2A1-      ccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaag
A0A3L7HT14_BCL2A1-      ccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaag
A0A3L7HT14_BCL2A1-      ------------------aagatgg------------------cttcatg
G3GTB4_BCL2A1-01        ------------------aagatgg------------------cttcatg
                                          ******                   * *** *

A0A3L7HT14_BCL2A1-      gacattttcaaacaaggcaaaatctgcttcatccctcggtaccggttcca
A0A3L7HT14_BCL2A1-      gacattttcaaacaaggcaaaatctgcttcatccctcggtaccggttcca
A0A3L7HT14_BCL2A1-      aagaagtttgaac----ctaaatctg-------gctgggtgacttttc--
G3GTB4_BCL2A1-01        aagaagtttgaac----ctaaatctg-------gctgggtgacttttc--
                         * *  **  ***    * *******        ** ***  *  ***  

A0A3L7HT14_BCL2A1-      gagcaatcacatggacatggtgagattagcatcacctgaagagatctctt
A0A3L7HT14_BCL2A1-      gagcaatcacatggacatggtgagattagcatcacctgaagagatctctt
A0A3L7HT14_BCL2A1-      -----------tggaaacgatagggcag-----atctgggaaatgctctt
G3GTB4_BCL2A1-01        -----------tggaaacgatagggcag-----atctgggaaatgctctt
                                   **** * * *  *         * ***   *   *****

A0A3L7HT14_BCL2A1-      tacttcccaa--aacatcctggaatattcatcagcccgctgagggagatg
A0A3L7HT14_BCL2A1-      tacttcccaa--aacatcctggaatattcatcagcccgctgagggagatg
A0A3L7HT14_BCL2A1-      ttctcctcaagcaaca-------------------ctactg--------g
G3GTB4_BCL2A1-01        ttctcctcaagcaaca-------------------ctactg--------g
                        * ** * ***  ****                   *  ***        *

A0A3L7HT14_BCL2A1-      ctcgagaggaggccttatccactggtggacttgacctcatcttcttgcca
A0A3L7HT14_BCL2A1-      ctcgagaggaggccttatccactggtggacttgacctcatcttcttgcca
A0A3L7HT14_BCL2A1-      ccagagag------------------------gaccctggctcc------
G3GTB4_BCL2A1-01        ccagagag------------------------gaccctggctcc------
                        *  *****                        ****    ** *      

A0A3L7HT14_BCL2A1-      ggccttgggtttgacaaagatggcaaccggctagggcggggcaagggcta
A0A3L7HT14_BCL2A1-      ggccttgggtttgacaaagatggcaaccggctagggcggggcaagggcta
A0A3L7HT14_BCL2A1-      ---------ttcgacaatggtgaccatcacttag----------------
G3GTB4_BCL2A1-01        ---------ttcgacaatggtgaccatcacttag----------------
                                 ** ***** * ** * * *   ***                

A0A3L7HT14_BCL2A1-      ctatgacacctacttgaagcgctgtgtgcagcaccaggaagtgaagccct
A0A3L7HT14_BCL2A1-      ctatgacacctacttgaagcgctgtgtgcagcaccaggaagtgaagccct
A0A3L7HT14_BCL2A1-      ----------tactt------ccatttgcaa-------------------
G3GTB4_BCL2A1-01        ----------tactt------ccatttgcaa-------------------
                                  *****      *  * ****                    

A0A3L7HT14_BCL2A1-      acaccttggctttggctttcaaagagcagatctgcccccaggtcccagtg
A0A3L7HT14_BCL2A1-      acaccttggctttggctttcaaagagcagatctgcccccaggtcccagtg
A0A3L7HT14_BCL2A1-      acaactcagc----------------------------------------
G3GTB4_BCL2A1-01        acaactcagc----------------------------------------
                        *** **  **                                        

A0A3L7HT14_BCL2A1-      gatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccagc
A0A3L7HT14_BCL2A1-      gatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccagc
A0A3L7HT14_BCL2A1-      --------tgacagga----------------------------------
G3GTB4_BCL2A1-01        --------tgacagga----------------------------------
                                ***** **                                  

A0A3L7HT14_BCL2A1-      atcttaa
A0A3L7HT14_BCL2A1-      atcttaa
A0A3L7HT14_BCL2A1-      --cttaa
G3GTB4_BCL2A1-01        --cttaa
                          *****

© 1998-2020Legal notice