Dataset for CDS BCL-2-like of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5PYQ3_BCL2A1-      atg-------------------------acagacagtgaatttggatata
A0A2K5PYQ3_BCL2A1-      atg-------------------------acagacagtgaatttggatata
A0A2K5PP81_BCL2-01      atggcgcaagctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5RIU7_BCL2L10      atggctgacccgctgcggca---gcgcaccgagcggctggtggcggacta
A0A2K5R5E2_MCL1-03      atgt----------ttggcc---tccaaagaaacg-----cggtaatcgg
A0A2K5R5E2_MCL1-04      atgt----------ttggcc---tccaaagaaacg-----cggtaatcgg
A0A2K5Q6R6_BCL2L1-      atgt---------------c---tcagagcaaccgggagctggtggttga
A0A2K5Q6R6_BCL2L1-      atgt---------------c---tcagagcaaccgggagctggtggttga
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      atggcgaccccagcctcggc---cccagacacacgggctctggtggcaga
A0A2K5RUN8_BCL2L2-      atggcgaccccagcctcggc---cccagacacacgggctctggtggcaga
                                                                          

A0A2K5PYQ3_BCL2A1-      ttc--------acaatctaactcaggactatctgtggtacgtc-------
A0A2K5PYQ3_BCL2A1-      ttc--------acaatctaactcaggactatctgtggtacgtc-------
A0A2K5PP81_BCL2-01      gtacatccactataagctgtcgcagag------gggctacgag-------
A0A2K5RIU7_BCL2L10      cct---------ggagtactgctcccg------ggagcccggc-------
A0A2K5R5E2_MCL1-03      act---------caacctctactgtgg------gggggccggc-------
A0A2K5R5E2_MCL1-04      act---------caacctctactgtgg------gggggccggc-------
A0A2K5Q6R6_BCL2L1-      ctttctctcctacaagctttcccagaa------aggatacagctggagtc
A0A2K5Q6R6_BCL2L1-      ctttctctcctacaagctttcccagaa------aggatacagctggagtc
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ctttgtaggttataagctgaggcagaa------gggttatgtc-------
A0A2K5RUN8_BCL2L2-      ctttgtaggttataagctgaggcagaa------gggttatgtc-------
                                                                          

A0A2K5PYQ3_BCL2A1-      ------------------------ctgcagataccacaat-ctggaacgg
A0A2K5PYQ3_BCL2A1-      ------------------------ctgcagataccacaat-ctggaacgg
A0A2K5PP81_BCL2-01      -----------tgggatgccggagatgtgggcgccgcgcccccaggggcc
A0A2K5RIU7_BCL2L10      ------------------acccccgagtcgccgccggcc--acggccgag
A0A2K5R5E2_MCL1-03      -----------ttgggggctggcagcggcggcgccacccctccgggagg-
A0A2K5R5E2_MCL1-04      -----------ttgggggctggcagcggcggcgccacccctccgggagg-
A0A2K5Q6R6_BCL2L1-      agtttagtgatgtggaagagaacaggactgaggcc------ccagaaggg
A0A2K5Q6R6_BCL2L1-      agtttagtgatgtggaagagaacaggactgaggcc------ccagaaggg
A0A2K5Q6R6_BCL2L1-      ---------atgtggaagagaacaggactgaggcc------ccagaaggg
A0A2K5RUN8_BCL2L2-      ----------tgtgga----------gctg--gcc------ccggggagg
A0A2K5RUN8_BCL2L2-      ----------tgtgga----------gctg--gcc------ccggggagg
                                                     *   **         *     

A0A2K5PYQ3_BCL2A1-      gtccaagcaaaa----------------cgtcca--------------ga
A0A2K5PYQ3_BCL2A1-      gtccaagcaaaa----------------cgtcca--------------ga
A0A2K5PP81_BCL2-01      gcccccgcgccgggcatcttctcctcccagcccgggcacacgcc----cg
A0A2K5RIU7_BCL2L10      gccgctgtgctg-----------cg---cgccac--------------cg
A0A2K5R5E2_MCL1-03      --------gcgg-----------cttttggccacggagaaggaggcctcg
A0A2K5R5E2_MCL1-04      --------gcgg-----------cttttggcgac--------------cg
A0A2K5Q6R6_BCL2L1-      actgattcggag-----------atggagacccc--------------ca
A0A2K5Q6R6_BCL2L1-      actgattcggag-----------atggagacccc--------------ca
A0A2K5Q6R6_BCL2L1-      actgattcggag-----------atggagacccc--------------ca
A0A2K5RUN8_BCL2L2-      gccca---gcag-----------ct---gacccg--------------ct
A0A2K5RUN8_BCL2L2-      gccca---gcag-----------ct---gacccg--------------ct
                                                                          

A0A2K5PYQ3_BCL2A1-      gtgcta--------------------------------------------
A0A2K5PYQ3_BCL2A1-      gtgcta--------------------------------------------
A0A2K5PP81_BCL2-01      gtcccgccgcgccccgggacccggtcgccaggacctcgccgccgtcgccc
A0A2K5RIU7_BCL2L10      ccgccggtgtacggaaagtc-----taccggtccttcttctccgcctacc
A0A2K5R5E2_MCL1-03      gc-ccagcg-agaggtaggg-----ggaggggaggccggcgcggtgattg
A0A2K5R5E2_MCL1-04      gcgccaagg-acacaaagcc-----aatgggcaggtc-------------
A0A2K5Q6R6_BCL2L1-      gtgccatca-atggcaaccc-----atcctggcacctggcggacagcccc
A0A2K5Q6R6_BCL2L1-      gtgccatca-atggcaaccc-----atcctggcacctggcggacagcccc
A0A2K5Q6R6_BCL2L1-      gtgccatca-at--------------------------------------
A0A2K5RUN8_BCL2L2-      gcacca--------------------------------------------
A0A2K5RUN8_BCL2L2-      gcacca--------------------------------------------
                           *                                              

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      ccggccgcccccgccgccgccgccaccgggcctgcgctcagcccggtg--
A0A2K5RIU7_BCL2L10      tcggctaccccgggaaccg-------------------------------
A0A2K5R5E2_MCL1-03      gcggaagcgtcggcgctagccccc----------------------cggc
A0A2K5R5E2_MCL1-04      -cggggccgccagcaggaaggctc----------------------tgg-
A0A2K5Q6R6_BCL2L1-      gcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggt
A0A2K5Q6R6_BCL2L1-      gcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggt
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      -------------------caaaaggttgcattctcagtccaaa------
A0A2K5PYQ3_BCL2A1-      -------------------caaaaggttgcattctcagtccaaa------
A0A2K5PP81_BCL2-01      -------ccacctgtggtccacctgaccctccgccaagccggcg------
A0A2K5RIU7_BCL2L10      ---------------cgtcgagctggtggcgaggatggcgg---------
A0A2K5R5E2_MCL1-03      cgccctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5E2_MCL1-04      -------agaccttacgacgggtggg------ggacggcgtgca------
A0A2K5Q6R6_BCL2L1-      gatccccatggcagcagtaaagcaagcactgagggaggcgggcg------
A0A2K5Q6R6_BCL2L1-      gatccccatggcagcagtaaagcaagcactgagggaggcgggcg------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ------------------------agcaatgcgggcagctggag------
A0A2K5RUN8_BCL2L2-      ------------------------agcaatgcgggcagctggag------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------acgacttctc-------------ccgccgctac---
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5R5E2_MCL1-03      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5E2_MCL1-04      ------------gcgcaaccacga-------------gacggccttc---
A0A2K5Q6R6_BCL2L1-      --------------acgagtttga-------------actgcggtac---
A0A2K5Q6R6_BCL2L1-      --------------acgagtttga-------------actgcggtac---
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------atgagttcga-------------gacccgcttc---
A0A2K5RUN8_BCL2L2-      --------------atgagttcga-------------gacccgcttc---
                                                                          

A0A2K5PYQ3_BCL2A1-      -------------agccatgcttggacaatgttaatattgtgtccataga
A0A2K5PYQ3_BCL2A1-      -------------agccatgcttggacaatgttaatattgtgtccataga
A0A2K5PP81_BCL2-01      -------------cgccgcgacttcgccgagatgtccagccagctgcacc
A0A2K5RIU7_BCL2L10      -------------aggcgctgctct-----ccgacagtcccggcccca--
A0A2K5R5E2_MCL1-03      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5E2_MCL1-04      -----------caaggca-tgcttcggaaactggacatcaaaaacgaaga
A0A2K5Q6R6_BCL2L1-      -------------cggcgggcatttagtgacctgacatcccagctccaca
A0A2K5Q6R6_BCL2L1-      -------------cggcgggcatttagtgacctgacatcccagctccaca
A0A2K5Q6R6_BCL2L1-      ------------------------------------------gctccaca
A0A2K5RUN8_BCL2L2-      -------------cggcgcaccttctctgatctggcggctcagctgcatg
A0A2K5RUN8_BCL2L2-      -------------cggcgcaccttctctgatctggcggctcagctgcatg
                                                                          

A0A2K5PYQ3_BCL2A1-      taatgccag------------aacgat-----------------attcag
A0A2K5PYQ3_BCL2A1-      taatgccag------------aacgat-----------------attcag
A0A2K5PP81_BCL2-01      tgacgcccttcaccgcgcggggacgct-------------------ttgc
A0A2K5RIU7_BCL2L10      -----cctggggcaacgtggtgatgct-----------------------
A0A2K5R5E2_MCL1-03      cgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
A0A2K5R5E2_MCL1-04      cgatgtcaaatctt--------------------------------tgtc
A0A2K5Q6R6_BCL2L1-      tcacccccgggacagcatatcaaagct-------------------ttga
A0A2K5Q6R6_BCL2L1-      tcacccccgggacagcatatcaaagct-------------------ttga
A0A2K5Q6R6_BCL2L1-      tcacccccgggacagcatatcaaagct-------------------ttga
A0A2K5RUN8_BCL2L2-      tgaccccaggctcagcccaacaacgct-------------------tcac
A0A2K5RUN8_BCL2L2-      tgaccccaggctcagcccaacaacgct-------------------tcac
                              *                                           

A0A2K5PYQ3_BCL2A1-      tcaagtgatggaaac-----------------------------------
A0A2K5PYQ3_BCL2A1-      tcaagtgatggaaac-----------------------------------
A0A2K5PP81_BCL2-01      cacggtggtggagg------------------------------------
A0A2K5RIU7_BCL2L10      tctggccttcgcggg-----------------------------------
A0A2K5R5E2_MCL1-03      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcct
A0A2K5R5E2_MCL1-04      tcgagtgatggtc-------------------------------------
A0A2K5Q6R6_BCL2L1-      acaagtagtgaacg------------------------------------
A0A2K5Q6R6_BCL2L1-      acaagtagtgaacg------------------------------------
A0A2K5Q6R6_BCL2L1-      acaagtagtgaacg------------------------------------
A0A2K5RUN8_BCL2L2-      ccaggtctccgatg------------------------------------
A0A2K5RUN8_BCL2L2-      ccaggtctccgatg------------------------------------
                            *                                             

A0A2K5PYQ3_BCL2A1-      ---ggaatttgaag----------------------atggcattattaac
A0A2K5PYQ3_BCL2A1-      ---ggaatttgaag----------------------atggcattattaac
A0A2K5PP81_BCL2-01      ---agctcttcagg------------------------gacggggtgaac
A0A2K5RIU7_BCL2L10      ---gacgctgctag-----------------------agagggggccgct
A0A2K5R5E2_MCL1-03      ggtaatggctccagtacggacgggtcactaccctcgacgccgccgccagc
A0A2K5R5E2_MCL1-04      ---catgttttcag--------------------cgacggcgtaacaaac
A0A2K5Q6R6_BCL2L1-      ---aactcttccgg------------------------gatggggtaaac
A0A2K5Q6R6_BCL2L1-      ---aactcttccgg------------------------gatggggtaaac
A0A2K5Q6R6_BCL2L1-      ---aactcttccgg------------------------gatggggtaaac
A0A2K5RUN8_BCL2L2-      ---aacttttccaa------------------------gggggccccaac
A0A2K5RUN8_BCL2L2-      ---aacttttccaa------------------------gggggccccaac
                                                              *           

A0A2K5PYQ3_BCL2A1-      tggggaag-aa----------ttgt---aaccatattt------------
A0A2K5PYQ3_BCL2A1-      tggggaag-aa----------ttgt---aaccatattt------------
A0A2K5PP81_BCL2-01      tgggggag-ga----------ttgt---ggccttcttt------------
A0A2K5RIU7_BCL2L10      ggtgaccgcccggtggaagaagtgg---ggcttccagt------------
A0A2K5R5E2_MCL1-03      agagg-ag-gaggaggacgagttgtaccggcagtcgctggagattatctc
A0A2K5R5E2_MCL1-04      tggggtag-ga----------ttgt---gactctcatt--------tatt
A0A2K5Q6R6_BCL2L1-      tggggtcg-ca----------ttgt---ggcctttttc------------
A0A2K5Q6R6_BCL2L1-      tggggtcg-ca----------ttgt---ggcctttttc------------
A0A2K5Q6R6_BCL2L1-      tggggtcg-ca----------ttgt---ggcctttttc------------
A0A2K5RUN8_BCL2L2-      tggggccg-cc----------ttgt---agccttcttt------------
A0A2K5RUN8_BCL2L2-      tggggccg-cc----------ttgt---agccttcttt------------
                         * *   *              **      *                   

A0A2K5PYQ3_BCL2A1-      -----gcatttgaa--------ggtattctcatcaagaaacttcta--ca
A0A2K5PYQ3_BCL2A1-      -----gcatttgaa--------ggtattctcatcaagaaacttcta--ca
A0A2K5PP81_BCL2-01      -----gagttcggtgg------ggtcatgtgtgtggagagcgtcaa--cc
A0A2K5RIU7_BCL2L10      --cgcggctgaaggagccggagggcaacgtctcccgggaccgccagcgcc
A0A2K5R5E2_MCL1-03      tcggtaccttcgggagc----aggcgaccggcgccaaggacacaaagcca
A0A2K5R5E2_MCL1-04      ttggtgcctttgtggcc----aaacacttg-----aagaccataaa-cca
A0A2K5Q6R6_BCL2L1-      -----tccttcggcgg------ggcactgtgcgtggaaagcgtaga--ca
A0A2K5Q6R6_BCL2L1-      -----tccttcggcgg------ggcactgtgcgtggaaagcgtaga--ca
A0A2K5Q6R6_BCL2L1-      -----tccttcggcgg------ggcactgtgcgtggaaagcgtaga--ca
A0A2K5RUN8_BCL2L2-      -----gtctttggggc------tgcactgtgtgctgagagtgtcaa--ca
A0A2K5RUN8_BCL2L2-      -----gtctttggggc------tgcactgtgtgctgagagtgtcaa--ca
                                *                                       * 

A0A2K5PYQ3_BCL2A1-      agagcgaattgccccggatgtggatacttataaggagatttcgtattttg
A0A2K5PYQ3_BCL2A1-      agagcgaattgccccggatgtggatacttataaggagatttcgtattttg
A0A2K5PP81_BCL2-01      gg---gag-----atgtcgcc----cctggtggacaacatcgccctgtgg
A0A2K5RIU7_BCL2L10      tg---gtgggcttgctgagctcgcggctcgtggggcagcaccgtgcctgg
A0A2K5R5E2_MCL1-03      at---gggcaggtccggggcc----gccagcaggaaggctc---------
A0A2K5R5E2_MCL1-04      ag---aaagctgcattgaacc----attagcagaaagtatc---------
A0A2K5Q6R6_BCL2L1-      ag---gag-----atgcaggt----attggtgagtcggatcgcagcttgg
A0A2K5Q6R6_BCL2L1-      ag---gag-----atgcaggt----attggtgagtcggatcgcagcttgg
A0A2K5Q6R6_BCL2L1-      ag---gag-----atgcaggt----attggtgagtcggatcgcagcttgg
A0A2K5RUN8_BCL2L2-      ag---gag-----atggaacc----actggtgggacaagtgcaggagtgg
A0A2K5RUN8_BCL2L2-      ag---gag-----atggaacc----actggtgggacaagtgcaggagtgg
                                                                          

A0A2K5PYQ3_BCL2A1-      ttgctga-gtacataatgaataacacaggagaatggataagacaaaac--
A0A2K5PYQ3_BCL2A1-      ttgctga-gtacataatgaataacacaggagaatggataagacaaaac--
A0A2K5PP81_BCL2-01      atgaccgagtacctgaaccggcacctgcacacctggatccaggataac--
A0A2K5RIU7_BCL2L10      ctggaggctca-------gggcggctgggtgagcacgcggagggggacac
A0A2K5R5E2_MCL1-03      -tggagacctt------acgacgggtgggggacggcgtgcagcgcaacca
A0A2K5R5E2_MCL1-04      --acagacgttctcgtaaggacaaaacgggactggc---tagttaaacaa
A0A2K5Q6R6_BCL2L1-      atggccacttacctgaatgaccacctagagccttggatccaggagaac--
A0A2K5Q6R6_BCL2L1-      atggccacttacctgaatgaccacctagagccttggatccaggagaac--
A0A2K5Q6R6_BCL2L1-      atggccacttacctgaatgaccacctagagccttggatccaggagaac--
A0A2K5RUN8_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagt--
A0A2K5RUN8_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagt--
                                                                          

A0A2K5PYQ3_BCL2A1-      gg---aggct-gg------gaaa--------------------------a
A0A2K5PYQ3_BCL2A1-      gg---aggctggg------ggaa--------------------------a
A0A2K5PP81_BCL2-01      gg---aggctg--------ggat------gccttt--------------g
A0A2K5RIU7_BCL2L10      ggggcgggatgggcacccgggaa------gggctcacccacgtgcccaga
A0A2K5R5E2_MCL1-03      cg---agacggccttccaaggat------gggttt--------------g
A0A2K5R5E2_MCL1-04      ag---aggctg--------ggat------gggttt--------------g
A0A2K5Q6R6_BCL2L1-      gg---cggctg--------ggac------actttt--------------g
A0A2K5Q6R6_BCL2L1-      gg---cggctg--------ggac------actttt--------------g
A0A2K5Q6R6_BCL2L1-      gg---cggctg--------ggac------actttt--------------g
A0A2K5RUN8_BCL2L2-      gg---gggctg--------ggagctggaagctatc--------------a
A0A2K5RUN8_BCL2L2-      gg---gggctg--------ggcg------gagttc--------------a
                         *    *            *                              

A0A2K5PYQ3_BCL2A1-      tgg-----------------------------------------------
A0A2K5PYQ3_BCL2A1-      tgg-----------------------------------------------
A0A2K5PP81_BCL2-01      tggaact-------------------------------------------
A0A2K5RIU7_BCL2L10      tggcttttgttac-------------------------------------
A0A2K5R5E2_MCL1-03      tggagttctt----------------------------------------
A0A2K5R5E2_MCL1-04      tggagttctt----------------------------------------
A0A2K5Q6R6_BCL2L1-      tggaact-------------------------------------------
A0A2K5Q6R6_BCL2L1-      tggaact-------------------------------------------
A0A2K5Q6R6_BCL2L1-      tggaact-------------------------------------------
A0A2K5RUN8_BCL2L2-      aagctcgagtcagggagatggaggaagaagctgagaagctaaaggaacta
A0A2K5RUN8_BCL2L2-      cagctctatacgggg-----------------------------------
                          *                                               

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      cagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgc
A0A2K5RUN8_BCL2L2-      ----acgggg----------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      -----------------ctttgtaaagaagtttgaacctaa---------
A0A2K5PYQ3_BCL2A1-      -----------------c--------acagtctcatgctta---------
A0A2K5PP81_BCL2-01      -----------------gtatgg------ccccagcatgcg---------
A0A2K5RIU7_BCL2L10      -----------------ttcttcaggacctcctactcactg---------
A0A2K5R5E2_MCL1-03      -----------------ccatgtagaggacc-tagaaggtg---------
A0A2K5R5E2_MCL1-04      -----------------ccatgtagaggacc-tagaaggtg---------
A0A2K5Q6R6_BCL2L1-      -----------------ctatggaaacaatg-cggcagccg---------
A0A2K5Q6R6_BCL2L1-      -----------------ctatggaaacaatg-cggcagccg---------
A0A2K5Q6R6_BCL2L1-      -----------------ctatggaaacaatg-cggcagccg---------
A0A2K5RUN8_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K5RUN8_BCL2L2-      -----------------ccctggaggaggcg-cggcgtctg---------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ----------------------------------------agagccga--
A0A2K5Q6R6_BCL2L1-      ----------------------------------------agagccga--
A0A2K5Q6R6_BCL2L1-      ----------------------------------------agagccga--
A0A2K5RUN8_BCL2L2-      ccatctatgttggcaatgtggactacggtgcaacagcagaagagctggaa
A0A2K5RUN8_BCL2L2-      ---------------------------------cgggaggggaactgg--
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      gctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtga
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      caaatttagtggccatcccaaagggtttgcatatatagagttctcagaca
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      --gcctctgttcgat-----------------------------------
A0A2K5RIU7_BCL2L10      --gcattatggagaa-----------------------------------
A0A2K5R5E2_MCL1-03      --gcatcagaaatg------------------------------------
A0A2K5R5E2_MCL1-04      --gcatcagaaatg------------------------------------
A0A2K5Q6R6_BCL2L1-      aagggccag-gagcgcttc-------------------------------
A0A2K5Q6R6_BCL2L1-      aagggccag-gagcgcttc-------------------------------
A0A2K5Q6R6_BCL2L1-      aagggccag-gagcgcttc-------------------------------
A0A2K5RUN8_BCL2L2-      aagagtcagtgaggacttccttggccttagacgagtccctatttagagga
A0A2K5RUN8_BCL2L2-      --gcatcagtgagga-----------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      -----atctggctggatgacttttct------------------------
A0A2K5PYQ3_BCL2A1-      -----tgctagtagagtcagtggccc------------------------
A0A2K5PP81_BCL2-01      -----ttctcctgg-----------ctgtctctgaagactctgctcagct
A0A2K5RIU7_BCL2L10      -----aattgctggtccaggttttcctgtcat------------------
A0A2K5R5E2_MCL1-03      -----tgctgctgg--------cttttgc---------------------
A0A2K5R5E2_MCL1-04      -----tgctgctgg--------cttttgc---------------------
A0A2K5Q6R6_BCL2L1-      -----aaccgctgg--------ttcctgac--------------------
A0A2K5Q6R6_BCL2L1-      -----aaccgctgg--------ttcctgac--------------------
A0A2K5Q6R6_BCL2L1-      -----aaccgctgg--------ttcctgac--------------------
A0A2K5RUN8_BCL2L2-      aggcaaatcaagg------------ttgacgttaaggctttcatttattc
A0A2K5RUN8_BCL2L2-      --------cagtg------------ctgac--------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PP81_BCL2-01      t-------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ---------------------------------------gggcat-----
A0A2K5Q6R6_BCL2L1-      ---------------------------------------gggcat-----
A0A2K5Q6R6_BCL2L1-      ---------------------------------------gggcat-----
A0A2K5RUN8_BCL2L2-      atctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagca
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      -----agaagtca-------------------------------------
A0A2K5PYQ3_BCL2A1-      -----agaagaag-------------------------------------
A0A2K5PP81_BCL2-01      -----ggccctgg-------------------------------------
A0A2K5RIU7_BCL2L10      -----ggttgtta-------------------------------------
A0A2K5R5E2_MCL1-03      -----aggtgttg-------------------------------------
A0A2K5R5E2_MCL1-04      -----aggtgttg-------------------------------------
A0A2K5Q6R6_BCL2L1-      -----gactgtgg-------------------------------------
A0A2K5Q6R6_BCL2L1-      -----gactgtgg-------------------------------------
A0A2K5Q6R6_BCL2L1-      -----gactgtgg-------------------------------------
A0A2K5RUN8_BCL2L2-      caacagaccggggttttccacgagcccgctaccgggcacggaccaccaac
A0A2K5RUN8_BCL2L2-      --aggggccgtgg----------------cactggg--------------
                                                                          

A0A2K5PYQ3_BCL2A1-      -----------------------------------------------cag
A0A2K5PYQ3_BCL2A1-      -----------------------------------------------agg
A0A2K5PP81_BCL2-01      -----------------------------------------------tgg
A0A2K5RIU7_BCL2L10      -------------acagcagcattcatctacttctggacacgataattag
A0A2K5R5E2_MCL1-03      -----------------------------------------------ctg
A0A2K5R5E2_MCL1-04      -----------------------------------------------ctg
A0A2K5Q6R6_BCL2L1-      -----------------------------------------------ccg
A0A2K5Q6R6_BCL2L1-      -----------------------------------------------ccg
A0A2K5Q6R6_BCL2L1-      -----------------------------------------------ccg
A0A2K5RUN8_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
A0A2K5RUN8_BCL2L2-      -------------------------------------------ggccctg
                                                                         *

A0A2K5PYQ3_BCL2A1-      gaa---agatctgtgaaatgc-------------------tatctctctt
A0A2K5PYQ3_BCL2A1-      aaa---atggctttgtaa--------------------------------
A0A2K5PP81_BCL2-01      gagcttgcatcaccctgggtg-------------------cctatctggg
A0A2K5RIU7_BCL2L10      gag-ttttaaaatttttagcc---------------cacttctacct-gc
A0A2K5R5E2_MCL1-03      gag-taggagctggtttggca---------------------tatct-aa
A0A2K5R5E2_MCL1-04      gag-taggagctggtttggca---------------------tatct-aa
A0A2K5Q6R6_BCL2L1-      gcg-tggt-tctgctgggctc-------------------actcttt-ag
A0A2K5Q6R6_BCL2L1-      gcg-tggt-tctgctgggctc-------------------actcttt-ag
A0A2K5Q6R6_BCL2L1-      gcg-tggt-tctgctgggctc-------------------actcttt-ag
A0A2K5RUN8_BCL2L2-      ggg-tcgcgtctacaggggccgggctagagcgacatcatggtattcc-cc
A0A2K5RUN8_BCL2L2-      ------gtaactgtaggggcc--------------------tttttt-gc
                                                                          

A0A2K5PYQ3_BCL2A1-      gaagcaatactattga
A0A2K5PYQ3_BCL2A1-      ----------------
A0A2K5PP81_BCL2-01      ccacaaa------tga
A0A2K5RIU7_BCL2L10      ccaactg------tga
A0A2K5R5E2_MCL1-03      taagatagccttgtaa
A0A2K5R5E2_MCL1-04      taagatag--------
A0A2K5Q6R6_BCL2L1-      tcggaaa------tga
A0A2K5Q6R6_BCL2L1-      tcggaaa------tga
A0A2K5Q6R6_BCL2L1-      tcggaaa------tga
A0A2K5RUN8_BCL2L2-      ttac---------taa
A0A2K5RUN8_BCL2L2-      tagcaag------tga
                                        

© 1998-2020Legal notice