Dataset for CDS BCL-2-like of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5PYQ3_BCL2A1-      ---------------------------------atgacagacagt---ga
A0A2K5PYQ3_BCL2A1-      ---------------------------------atgacagacagt---ga
A0A2K5RIU7_BCL2L10      ---------------------------------atggctgaccc-----g
A0A2K5PP81_BCL2-01      ---------------------------------atggcgcaagctgggag
A0A2K5R5E2_MCL1-02      ---------------------------------atgtt------------
A0A2K5R5E2_MCL1-03      ---------------------------------atgtt------------
A0A2K5R5E2_MCL1-01      ---------------------------------atgtt------------
A0A2K5R5E2_MCL1-04      ---------------------------------atgtt------------
A0A2K5Q6R6_BCL2L1-      ---------------------------------atgtc------------
A0A2K5Q6R6_BCL2L1-      ---------------------------------atgtc------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcggcggc----gg
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcggcggc----gg
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcgacccc----ag
A0A2K5RUN8_BCL2L2-      catctttcatccttgcctcttatagccgcccggatggcgacccc----ag
A0A2K5RUN8_BCL2L2-      ---------------------------------atggcgacccc----ag
                                                                          

A0A2K5PYQ3_BCL2A1-      atttggatatattcacaat-----------------------ctaactca
A0A2K5PYQ3_BCL2A1-      atttggatatattcacaat-----------------------ctaactca
A0A2K5RIU7_BCL2L10      ctgcggcagcgcaccgagcgg---------------------ctggtggc
A0A2K5PP81_BCL2-01      aacagggtacgataaccgggagatagtgatgaagtacatccactataagc
A0A2K5R5E2_MCL1-02      ---tggcctccaaagaaacgcggtaatcggactcaacctctactgtgggg
A0A2K5R5E2_MCL1-03      ---tggcctccaaagaaacgcggtaatcggactcaacctctactgtgggg
A0A2K5R5E2_MCL1-01      ---tggcctccaaagaaacgcggtaatcggactcaacctctactgtgggg
A0A2K5R5E2_MCL1-04      ---tggcctccaaagaaacgcggtaatcggactcaacctctactgtgggg
A0A2K5Q6R6_BCL2L1-      --------tcagagcaaccgggag------------------ctggtggt
A0A2K5Q6R6_BCL2L1-      --------tcagagcaaccgggag------------------ctggtggt
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      cggcggcggcagcagcagcggggg------------------ctgcgggc
A0A2K5RUN8_BCL2L2-      cggcggcggcagcagcagcggggg------------------ctgcgggc
A0A2K5RUN8_BCL2L2-      cctcggccccagacaca-cgggct------------------ctggtggc
A0A2K5RUN8_BCL2L2-      cctcggccccagacaca-cgggct------------------ctggtggc
A0A2K5RUN8_BCL2L2-      cctcggccccagacaca-cgggct------------------ctggtggc
                                                                          

A0A2K5PYQ3_BCL2A1-      ggactatctgtggtacgtcc------------------------------
A0A2K5PYQ3_BCL2A1-      ggactatctgtggtacgtcc------------------------------
A0A2K5RIU7_BCL2L10      ggactacctggagtactgctcc----------------------------
A0A2K5PP81_BCL2-01      tgtc--gcagaggggctacgag----------------------------
A0A2K5R5E2_MCL1-02      gggccggcttgggggctggcag----------------------------
A0A2K5R5E2_MCL1-03      gggccggcttgggggctggcag----------------------------
A0A2K5R5E2_MCL1-01      gggccggcttgggggctggcag----------------------------
A0A2K5R5E2_MCL1-04      gggccggcttgggggctggcag----------------------------
A0A2K5Q6R6_BCL2L1-      tgac---tttctctcctacaagctttcccagaaaggatacagctggagtc
A0A2K5Q6R6_BCL2L1-      tgac---tttctctcctacaagctttcccagaaaggatacagctggagtc
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ggtc-------ggggctccggg----------------------------
A0A2K5RUN8_BCL2L2-      ggtc-------ggggctccggg----------------------------
A0A2K5RUN8_BCL2L2-      agac---tttgtaggttataag----------------------------
A0A2K5RUN8_BCL2L2-      agac---tttgtaggttataag----------------------------
A0A2K5RUN8_BCL2L2-      agac---tttgtaggttataag----------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      ---------------------------tgcagataccacaatctggaacg
A0A2K5PYQ3_BCL2A1-      ---------------------------tgcagataccacaatctggaacg
A0A2K5RIU7_BCL2L10      ---------------------------cgggagcccggcacccccgagtc
A0A2K5PP81_BCL2-01      -------------tgggatgccggagatgtgggcgccgcgcccccagggg
A0A2K5R5E2_MCL1-02      ---------------------------cggcggcgccacccctccgggag
A0A2K5R5E2_MCL1-03      ---------------------------cggcggcgccacccctccgggag
A0A2K5R5E2_MCL1-01      ---------------------------cggcggcgccacccctccgggag
A0A2K5R5E2_MCL1-04      ---------------------------cggcggcgccacccctccgggag
A0A2K5Q6R6_BCL2L1-      agtttagtgatgtggaagagaacaggactgaggcccca--------gaag
A0A2K5Q6R6_BCL2L1-      agtttagtgatgtggaagagaacaggactgaggcccca--------gaag
A0A2K5Q6R6_BCL2L1-      ---------atgtggaagagaacaggactgaggcccca--------gaag
A0A2K5RUN8_BCL2L2-      ---------------------------ccggggc------------ggcg
A0A2K5RUN8_BCL2L2-      ---------------------------ccggggc------------ggcg
A0A2K5RUN8_BCL2L2-      ---------------------------ctgaggc------------agaa
A0A2K5RUN8_BCL2L2-      ---------------------------ctgaggc------------agaa
A0A2K5RUN8_BCL2L2-      ---------------------------ctgaggc------------agaa
                                                                          

A0A2K5PYQ3_BCL2A1-      ------------ggtccaagcaaaacgtccag------------------
A0A2K5PYQ3_BCL2A1-      ------------ggtccaagcaaaacgtccag------------------
A0A2K5RIU7_BCL2L10      gccgccggccacggccga----ggccgctgtg------------------
A0A2K5PP81_BCL2-01      ccgcccccgcgccgggcatcttctcctcccagcccgggcacacgcccggt
A0A2K5R5E2_MCL1-02      ------------ggcggcttttggccacggag---------------aag
A0A2K5R5E2_MCL1-03      ------------ggcggcttttggccacggag---------------aag
A0A2K5R5E2_MCL1-01      ------------ggcggcttttggccacggag---------------aag
A0A2K5R5E2_MCL1-04      ------------ggcggctttt----------------------------
A0A2K5Q6R6_BCL2L1-      ------------ggactgattcggagatggagacccccagtgccatcaat
A0A2K5Q6R6_BCL2L1-      ------------ggactgattcggagatggagacccccagtgccatcaat
A0A2K5Q6R6_BCL2L1-      ------------ggactgattcggagatggagacccccagtgccatcaat
A0A2K5RUN8_BCL2L2-      ------------gcgccatcttgtgcccgggg------------------
A0A2K5RUN8_BCL2L2-      ------------gcgccatcttgtgcccgggg------------------
A0A2K5RUN8_BCL2L2-      ------------gggtta---tgtctgtggag------------------
A0A2K5RUN8_BCL2L2-      ------------gggtta---tgtctgtggag------------------
A0A2K5RUN8_BCL2L2-      ------------gggtta---tgtctgtggag------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --ctgcgcgccaccgccgccggtgtac-----------------------
A0A2K5PP81_BCL2-01      cccgccgcgccccgggacccggtcgccaggacctcgccgccgtcgccccc
A0A2K5R5E2_MCL1-02      gaggcctcggcccagcgagaggtagggggaggggaggccggcgcggtgat
A0A2K5R5E2_MCL1-03      gaggcctcggcccagcgagaggtagggggaggggaggccggcgcggtgat
A0A2K5R5E2_MCL1-01      gaggcctcggcccagcgagaggtagggggaggggaggccggcgcggtgat
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ggcaacccatcctggcacctggcggacagccccgcggtgaatggagccac
A0A2K5Q6R6_BCL2L1-      ggcaacccatcctggcacctggcggacagccccgcggtgaatggagccac
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      -----------ccggt----gg----------------------------
A0A2K5RUN8_BCL2L2-      -----------ccggt----gg----------------------------
A0A2K5RUN8_BCL2L2-      -----------ctggccccggg----------------------------
A0A2K5RUN8_BCL2L2-      -----------ctggccccggg----------------------------
A0A2K5RUN8_BCL2L2-      -----------ctggccccggg----------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      ------------------ggaaagtctaccggtccttcttctccgcctac
A0A2K5PP81_BCL2-01      ggccgcccccgccgccgccgccaccgggcctgcgctcagcccggtgccac
A0A2K5R5E2_MCL1-02      tggc--------------ggaagcgtcg---gcgctagccccccggccgc
A0A2K5R5E2_MCL1-03      tggc--------------ggaagcgtcg---gcgctagccccccggccgc
A0A2K5R5E2_MCL1-01      tggc--------------ggaagcgtcg---gcgctagccccccggccgc
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      gggccacagcagcagtttggatgcccgg---gaggtgatccccatggcag
A0A2K5Q6R6_BCL2L1-      gggccacagcagcagtttggatgcccgg---gaggtgatccccatggcag
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ------------------ggaggccggg---gagggggccc---------
A0A2K5RUN8_BCL2L2-      ------------------ggaggccggg---gagggggccc---------
A0A2K5RUN8_BCL2L2-      ------------------gagggcccag---cagctgacccgc-------
A0A2K5RUN8_BCL2L2-      ------------------gagggcccag---cagctgacccgc-------
A0A2K5RUN8_BCL2L2-      ------------------gagggcccag---cagctgacccgc-------
                                                                          

A0A2K5PYQ3_BCL2A1-      -------------agtgctacaaaaggttgc-------------------
A0A2K5PYQ3_BCL2A1-      -------------agtgctacaaaaggttgc-------------------
A0A2K5RIU7_BCL2L10      ctcggctaccccgggaaccgcgtcgagctgg-------------------
A0A2K5PP81_BCL2-01      ctgtggtccacctgaccctccgccaagccgg-------------------
A0A2K5R5E2_MCL1-02      cctca---cgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5E2_MCL1-03      cctca---cgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5E2_MCL1-01      cctca---cgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      cagta---aagcaagcactgagggaggcggg-------------------
A0A2K5Q6R6_BCL2L1-      cagta---aagcaagcactgagggaggcggg-------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------cggggggc-gc-------------------
A0A2K5RUN8_BCL2L2-      --------------------cggggggc-gc-------------------
A0A2K5RUN8_BCL2L2-      ---tg---caccaagcaatgcgggcagctgg-------------------
A0A2K5RUN8_BCL2L2-      ---tg---caccaagcaatgcgggcagctgg-------------------
A0A2K5RUN8_BCL2L2-      ---tg---caccaagcaatgcgggcagctgg-------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      ----------------------------------------attctcag--
A0A2K5PYQ3_BCL2A1-      ----------------------------------------attctcag--
A0A2K5RIU7_BCL2L10      ----------tggcgag----------gatggcggaggcgctgctctc--
A0A2K5PP81_BCL2-01      ----------cgacgacttctcccgccgctaccgccgcgacttcgccgag
A0A2K5R5E2_MCL1-02      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5E2_MCL1-03      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5E2_MCL1-01      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ----------cgacgagtttgaactgcggtaccggcgggcatttagtg-a
A0A2K5Q6R6_BCL2L1-      ----------cgacgagtttgaactgcggtaccggcgggcatttagtg-a
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ----------aggggactacgggaacggcctggag---------tctg-a
A0A2K5RUN8_BCL2L2-      ----------aggggactacgggaacggcctggag---------tctg-a
A0A2K5RUN8_BCL2L2-      ----------agatgagttcgagacccgcttccggcgcaccttctctg-a
A0A2K5RUN8_BCL2L2-      ----------agatgagttcgagacccgcttccggcgcaccttctctg-a
A0A2K5RUN8_BCL2L2-      ----------agatgagttcgagacccgcttccggcgcaccttctctg-a
                                                                          

A0A2K5PYQ3_BCL2A1-      ---tccaaaagccatgcttggacaatgttaatattgtgtccatagataa-
A0A2K5PYQ3_BCL2A1-      ---tccaaaagccatgcttggacaatgttaatattgtgtccatagataa-
A0A2K5RIU7_BCL2L10      ----cgacagtcccggccccacctg------------------gggcaa-
A0A2K5PP81_BCL2-01      atgtccagc----cagctgcacctg-----------acgcccttcaccg-
A0A2K5R5E2_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5E2_MCL1-03      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5E2_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      c---ctgacatcccagctccacatc-----------acccccgggacag-
A0A2K5Q6R6_BCL2L1-      c---ctgacatcccagctccacatc-----------acccccgggacag-
A0A2K5Q6R6_BCL2L1-      ---------------gctccacatc-----------acccccgggacag-
A0A2K5RUN8_BCL2L2-      ggaactggagcctgaggagctgctgctggagcccgagccggagcccgag-
A0A2K5RUN8_BCL2L2-      ggaactggagcctgagga--------------------------------
A0A2K5RUN8_BCL2L2-      t---ctggcggctcagctgcatgtg-----------accccaggctcag-
A0A2K5RUN8_BCL2L2-      t---ctggcggctcagctgcatgtg-----------accccaggctcag-
A0A2K5RUN8_BCL2L2-      t---ctggcggctcagctgcatgtg-----------accccaggctcag-
                                                                          

A0A2K5PYQ3_BCL2A1-      -------------tgccagaacgatattcagtcaagtgatggaaacggaa
A0A2K5PYQ3_BCL2A1-      -------------tgccagaacgatattcagtcaagtgatggaaacggaa
A0A2K5RIU7_BCL2L10      -------------cgtggtgatg--cttc---tggccttcgcggggacgc
A0A2K5PP81_BCL2-01      -------------cgcggggacg--ctttgccacggtggtggaggagctc
A0A2K5R5E2_MCL1-02      cgccatcatgtctcccgaagaag--agctggacgggtacgagccagagcc
A0A2K5R5E2_MCL1-03      cgccatcatgtctcccgaagaag--agctggacgggtacgagccagagcc
A0A2K5R5E2_MCL1-01      cgccatcatgtctcccgaagaag--agctggacgggtacgagccagagcc
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      -------------catatcaaag--ctttgaacaagtagtgaacgaactc
A0A2K5Q6R6_BCL2L1-      -------------catatcaaag--ctttgaacaagtagtgaacgaactc
A0A2K5Q6R6_BCL2L1-      -------------catatcaaag--ctttgaacaagtagtgaacgaactc
A0A2K5RUN8_BCL2L2-      -------------cctgaagagg--agccgccccggcccc------gcgc
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      -------------cccaacaacg--cttcacccaggtctccgatgaactt
A0A2K5RUN8_BCL2L2-      -------------cccaacaacg--cttcacccaggtctccgatgaactt
A0A2K5RUN8_BCL2L2-      -------------cccaacaacg--cttcacccaggtctccgatgaactt
                                                                          

A0A2K5PYQ3_BCL2A1-      tttgaagatggcattattaactgg--------------------------
A0A2K5PYQ3_BCL2A1-      tttgaagatggcattattaactgg--------------------------
A0A2K5RIU7_BCL2L10      tgctagagaggg---ggccgctggtgaccgcccggt--------------
A0A2K5PP81_BCL2-01      ttcagggacggg---gtgaactgg--------------------------
A0A2K5R5E2_MCL1-02      tctcgggaagcg---gccggctgtcctgcccctgctggagttggtcgggg
A0A2K5R5E2_MCL1-03      tctcgggaagcg---gccggctgtcctgcccctgctggagttggtcgggg
A0A2K5R5E2_MCL1-01      tctcgggaagcg---gccggctgtcctgcccctgctggagttggtcgggg
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ttccgggatggg---gtaaactgg--------------------------
A0A2K5Q6R6_BCL2L1-      ttccgggatggg---gtaaactgg--------------------------
A0A2K5Q6R6_BCL2L1-      ttccgggatggg---gtaaactgg--------------------------
A0A2K5RUN8_BCL2L2-      ccccccgggagc---tccg-------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ttccaagggggc---cccaactgg--------------------------
A0A2K5RUN8_BCL2L2-      ttccaagggggc---cccaactgg--------------------------
A0A2K5RUN8_BCL2L2-      ttccaagggggc---cccaactgg--------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      ----------------------ggaagaattgtaaccatatttgcatttg
A0A2K5PYQ3_BCL2A1-      ----------------------ggaagaattgtaaccatatttgcatttg
A0A2K5RIU7_BCL2L10      ----------------------ggaagaagtggggcttccagtcgcggct
A0A2K5PP81_BCL2-01      ----------------------gggaggattgtggccttctttgagttcg
A0A2K5R5E2_MCL1-02      agcctggtaatggctccagtacggacgggtcactaccctcgacgccgccg
A0A2K5R5E2_MCL1-03      agcctggtaatggctccagtacggacgggtcactaccctcgacgccgccg
A0A2K5R5E2_MCL1-01      agcctggtaatggctccagtacggacgggtcactaccctcgacgccgccg
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ----------------------ggtcgcattgtggcctttttctccttcg
A0A2K5Q6R6_BCL2L1-      ----------------------ggtcgcattgtggcctttttctccttcg
A0A2K5Q6R6_BCL2L1-      ----------------------ggtcgcattgtggcctttttctccttcg
A0A2K5RUN8_BCL2L2-      ---------------------------------ggccctgggcctggttc
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ----------------------ggccgccttgtagccttctttgtctttg
A0A2K5RUN8_BCL2L2-      ----------------------ggccgccttgtagccttctttgtctttg
A0A2K5RUN8_BCL2L2-      ----------------------ggccgccttgtagccttctttgtctttg
                                                                          

A0A2K5PYQ3_BCL2A1-      -----------------------aaggtattctcatc-------------
A0A2K5PYQ3_BCL2A1-      -----------------------aaggtattctcatc-------------
A0A2K5RIU7_BCL2L10      ---------------------gaaggagccggagggc-------------
A0A2K5PP81_BCL2-01      ---------------------gtggggtcatgtgtgt-------------
A0A2K5R5E2_MCL1-02      ccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattat
A0A2K5R5E2_MCL1-03      ccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattat
A0A2K5R5E2_MCL1-01      ccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattat
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ---------------------gcggggcactgtgcgt-------------
A0A2K5Q6R6_BCL2L1-      ---------------------gcggggcactgtgcgt-------------
A0A2K5Q6R6_BCL2L1-      ---------------------gcggggcactgtgcgt-------------
A0A2K5RUN8_BCL2L2-      ---------------------gggagcccccggcagt-------------
A0A2K5RUN8_BCL2L2-      ------------------------------------t-------------
A0A2K5RUN8_BCL2L2-      ---------------------gggctgcactgtgtgc-------------
A0A2K5RUN8_BCL2L2-      ---------------------gggctgcactgtgtgc-------------
A0A2K5RUN8_BCL2L2-      ---------------------gggctgcactgtgtgc-------------
                                                                          

A0A2K5PYQ3_BCL2A1-      ---------------------aagaaacttctacaagagcgaattgcccc
A0A2K5PYQ3_BCL2A1-      ---------------------aagaaacttctacaagagcgaattgcccc
A0A2K5RIU7_BCL2L10      -------------------------aacgtctcccgggaccgccagcgcc
A0A2K5PP81_BCL2-01      ---------------------ggagagcgtcaaccgggagatgtcgcccc
A0A2K5R5E2_MCL1-02      ctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaa
A0A2K5R5E2_MCL1-03      ctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaa
A0A2K5R5E2_MCL1-01      ctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaa
A0A2K5R5E2_MCL1-04      ---------------------ggcgaccggcgccaaggacacaaagccaa
A0A2K5Q6R6_BCL2L1-      ---------------------ggaaagcgtagacaaggagatgcaggtat
A0A2K5Q6R6_BCL2L1-      ---------------------ggaaagcgtagacaaggagatgcaggtat
A0A2K5Q6R6_BCL2L1-      ---------------------ggaaagcgtagacaaggagatgcaggtat
A0A2K5RUN8_BCL2L2-      ---------------------caagag-------gaggaggaggagcc--
A0A2K5RUN8_BCL2L2-      ---------------------caagag-------gaggaggaggagcc--
A0A2K5RUN8_BCL2L2-      ---------------------tgagagtgtcaacaaggagatggaaccac
A0A2K5RUN8_BCL2L2-      ---------------------tgagagtgtcaacaaggagatggaaccac
A0A2K5RUN8_BCL2L2-      ---------------------tgagagtgtcaacaaggagatggaaccac
                                                 *          *             

A0A2K5PYQ3_BCL2A1-      ggatg---------------tggat----------------acttataag
A0A2K5PYQ3_BCL2A1-      ggatg---------------tggat----------------acttataag
A0A2K5RIU7_BCL2L10      tggtgggcttgctgagctcgcggctcgtggggcagcaccgtgcctggctg
A0A2K5PP81_BCL2-01      tggtggacaacatcgccctgtggatgacc------------gagtacctg
A0A2K5R5E2_MCL1-02      tgggcaggtccggggccgccagcaggaag------------gc---tctg
A0A2K5R5E2_MCL1-03      tgggcaggtccggggccgccagcaggaag------------gc---tctg
A0A2K5R5E2_MCL1-01      tgggcaggtccggggccgccagcaggaag------------gc---tctg
A0A2K5R5E2_MCL1-04      tgggcaggtccggggccgccagcaggaag------------gc---tctg
A0A2K5Q6R6_BCL2L1-      tggtgagtcggatcgcagcttggatggcc------------acttacctg
A0A2K5Q6R6_BCL2L1-      tggtgagtcggatcgcagcttggatggcc------------acttacctg
A0A2K5Q6R6_BCL2L1-      tggtgagtcggatcgcagcttggatggcc------------acttacctg
A0A2K5RUN8_BCL2L2-      ----gggac--------tggtcgagggtg------------ac---ccgg
A0A2K5RUN8_BCL2L2-      ----gggac--------tggtcgagggtg------------ac---ccgg
A0A2K5RUN8_BCL2L2-      tggtgggacaagtgcaggagtggatggtg------------gcctacctg
A0A2K5RUN8_BCL2L2-      tggtgggacaagtgcaggagtggatggtg------------gcctacctg
A0A2K5RUN8_BCL2L2-      tggtgggacaagtgcaggagtggatggtg------------gcctacctg
                                                                         *

A0A2K5PYQ3_BCL2A1-      gagatttcgtattttgttgctgagtacataatgaataaca-----cagga
A0A2K5PYQ3_BCL2A1-      gagatttcgtattttgttgctgagtacataatgaataaca-----cagga
A0A2K5RIU7_BCL2L10      gaggc-tcagggcggctg------------------ggtgagcacgcgga
A0A2K5PP81_BCL2-01      ------------------------------------aaccggcacctgc-
A0A2K5R5E2_MCL1-02      gagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagacgg-
A0A2K5R5E2_MCL1-03      gagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagacgg-
A0A2K5R5E2_MCL1-01      gagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagacgg-
A0A2K5R5E2_MCL1-04      gagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagacgg-
A0A2K5Q6R6_BCL2L1-      ------------------------------------aatgaccacctaga
A0A2K5Q6R6_BCL2L1-      ------------------------------------aatgaccacctaga
A0A2K5Q6R6_BCL2L1-      ------------------------------------aatgaccacctaga
A0A2K5RUN8_BCL2L2-      gggac------ggcgc-------------------cattgaggacccgga
A0A2K5RUN8_BCL2L2-      gggac------ggcgc-------------------cattgaggacccgga
A0A2K5RUN8_BCL2L2-      gagac------gcggctggccgactggatccacagcagtgggggctggga
A0A2K5RUN8_BCL2L2-      gagac------gcggctggccgactggatccacagcagtgggggctgggc
A0A2K5RUN8_BCL2L2-      gagac------gcggctggccgactggatccacagcagtgggggctgggc
                                                                          

A0A2K5PYQ3_BCL2A1-      gaatggataagacaaaacggaggct-ggg---------------------
A0A2K5PYQ3_BCL2A1-      gaatggataagacaaaacggaggctgggg---------------------
A0A2K5RIU7_BCL2L10      g-------------------------ggg---------------------
A0A2K5PP81_BCL2-01      --------------acacctggatccagg---------------------
A0A2K5R5E2_MCL1-02      -------ccttccaaggcatgcttcggaaactggacatcaaaaacgaaga
A0A2K5R5E2_MCL1-03      -------ccttccaa-----------------------------------
A0A2K5R5E2_MCL1-01      -------ccttccaaggcatgcttcggaaactggacatcaaaaacgaaga
A0A2K5R5E2_MCL1-04      -------ccttccaaggcatgcttcggaaactggacatcaaaaacgaaga
A0A2K5Q6R6_BCL2L1-      gc---------------cttggatccagg---------------------
A0A2K5Q6R6_BCL2L1-      gc---------------cttggatccagg---------------------
A0A2K5Q6R6_BCL2L1-      gc---------------cttggatccagg---------------------
A0A2K5RUN8_BCL2L2-      gctggaagctatcaaagctcgagtcagggagatggaggaagaagctgaga
A0A2K5RUN8_BCL2L2-      gctggaagctatcaaagctcgagtcagggagatggaggaagaagctgaga
A0A2K5RUN8_BCL2L2-      gctggaagctatcaaagctcgagtcagggagatggaggaagaagctgaga
A0A2K5RUN8_BCL2L2-      g------gagttcacagctctatacgggg---------------------
A0A2K5RUN8_BCL2L2-      g------gagttcacagctctatacgggg---------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      ---------------aaaatgg----------------------------
A0A2K5PYQ3_BCL2A1-      ---------------gaaatgg----------------------------
A0A2K5RIU7_BCL2L10      ---------------gacacggggcgggatgggcacccgggaagggctca
A0A2K5PP81_BCL2-01      ---------------ataacggag--------------------------
A0A2K5R5E2_MCL1-02      cgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcg
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-01      cgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcg
A0A2K5R5E2_MCL1-04      cgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcg
A0A2K5Q6R6_BCL2L1-      ---------------agaacggcg--------------------------
A0A2K5Q6R6_BCL2L1-      ---------------agaacggcg--------------------------
A0A2K5Q6R6_BCL2L1-      ---------------agaacggcg--------------------------
A0A2K5RUN8_BCL2L2-      agctaaaggaactacagaacgaggtagagaagcagatgaatatgagtcca
A0A2K5RUN8_BCL2L2-      agctaaaggaactacagaacgaggtagagaagcagatgaatatgagtcca
A0A2K5RUN8_BCL2L2-      agctaaaggaactacagaacgaggtagagaagcagatgaatatgagtcca
A0A2K5RUN8_BCL2L2-      ------------------acgggg--------------------------
A0A2K5RUN8_BCL2L2-      ------------------acgggg--------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------ctttgtaaagaagtttga
A0A2K5PYQ3_BCL2A1-      --------------------------------c--------acagtctca
A0A2K5RIU7_BCL2L10      cccacgtgcccagatgg--------------cttttgttacttcttcagg
A0A2K5PP81_BCL2-01      ------------gctgggatg----------cctttgtggaa--------
A0A2K5R5E2_MCL1-02      taacaaactggggtaggattgtgactctcatttattttggtgcctttgtg
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-01      taacaaactggggtaggattgtgactctcatttattttggtgcctttgtg
A0A2K5R5E2_MCL1-04      taacaaactggggtaggattgtgactctcatttattttggtgcctttgtg
A0A2K5Q6R6_BCL2L1-      ------------gctgggaca----------cttttgtggaa--------
A0A2K5Q6R6_BCL2L1-      ------------gctgggaca----------cttttgtggaa--------
A0A2K5Q6R6_BCL2L1-      ------------gctgggaca----------cttttgtggaa--------
A0A2K5RUN8_BCL2L2-      cctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgga
A0A2K5RUN8_BCL2L2-      cctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgga
A0A2K5RUN8_BCL2L2-      cctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgga
A0A2K5RUN8_BCL2L2-      -------------------------------ccctggaggaggcg-cggc
A0A2K5RUN8_BCL2L2-      -------------------------------ccctggaggaggcg-cggc
                                                                          

A0A2K5PYQ3_BCL2A1-      acctaaatctggctggat---------------------gacttttctag
A0A2K5PYQ3_BCL2A1-      tgcttatgctagtagagt---------------------cagtggcccag
A0A2K5RIU7_BCL2L10      acctcctactcactggcattatggagaaaatt------------------
A0A2K5PP81_BCL2-01      ------------------------------------ctgtatggccccag
A0A2K5R5E2_MCL1-02      gccaaacacttgaagaccataaaccaagaaag----ctgcattgaaccat
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-01      gccaaacacttgaagaccataaaccaagaaag----ctgcattgaaccat
A0A2K5R5E2_MCL1-04      gccaaacacttgaagaccataaaccaagaaag----ctgcattgaaccat
A0A2K5Q6R6_BCL2L1-      ----------------ctctatggaaacaatg---------------cgg
A0A2K5Q6R6_BCL2L1-      ----------------ctctatggaaacaatg---------------cgg
A0A2K5Q6R6_BCL2L1-      ----------------ctctatggaaacaatg---------------cgg
A0A2K5RUN8_BCL2L2-      ggctgatgcccgttccatctatgttggcaatgtggactacggtgcaacag
A0A2K5RUN8_BCL2L2-      ggctgatgcccgttccatctatgttggcaatgtggactacggtgcaacag
A0A2K5RUN8_BCL2L2-      ggctgatgcccgttccatctatgttggcaatgtggactacggtgcaacag
A0A2K5RUN8_BCL2L2-      gtctg------------------------------------------cgg
A0A2K5RUN8_BCL2L2-      gtctg------------------------------------------cgg
                                                                          

A0A2K5PYQ3_BCL2A1-      aagtcacagg----------------------------------------
A0A2K5PYQ3_BCL2A1-      aagaagagga----------------------------------------
A0A2K5RIU7_BCL2L10      -----gctggtccaggttttcctgtcatggttgtt---------------
A0A2K5PP81_BCL2-01      cat--gcggcctctgttcgatttctcctggct------------------
A0A2K5R5E2_MCL1-02      tagcagaaagtatcacagacgttctcgt----------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-01      tagcagaaagtatcacagacgttctcgt----------------------
A0A2K5R5E2_MCL1-04      tagcagaaagtatcacagacgttctcgt----------------------
A0A2K5Q6R6_BCL2L1-      cagccgagagccga------------------------------------
A0A2K5Q6R6_BCL2L1-      cagccgagagccga------------------------------------
A0A2K5Q6R6_BCL2L1-      cagccgagagccga------------------------------------
A0A2K5RUN8_BCL2L2-      cag--aagagctggaagctcactttcatggctgtggttcagtcaaccgtg
A0A2K5RUN8_BCL2L2-      cag--aagagctggaagctcactttcatggctgtggttcagtcaaccgtg
A0A2K5RUN8_BCL2L2-      cag--aagagctggaagctcactttcatggctgtggttcagtcaaccgtg
A0A2K5RUN8_BCL2L2-      gag--gggaactgg------------------------------------
A0A2K5RUN8_BCL2L2-      gag--gggaactgg------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5R5E2_MCL1-02      ------------------------------------aaggacaaaacggg
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-01      ------------------------------------aaggacaaaacggg
A0A2K5R5E2_MCL1-04      ------------------------------------aaggacaaaacggg
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      ttaccatactctgtgacaaatttagtggccatcccaaagggtttgcatat
A0A2K5RUN8_BCL2L2-      ttaccatactctgtgacaaatttagtggccatcccaaagggtttgcatat
A0A2K5RUN8_BCL2L2-      ttaccatactctgtgacaaatttagtggccatcccaaagggtttgcatat
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------gtctctgaagactctgctcagcttggccct
A0A2K5R5E2_MCL1-02      actggctagttaaacaaagaggctgggatgggtttgtggagttc------
A0A2K5R5E2_MCL1-03      -------------------------ggatgggtttgtggagttc------
A0A2K5R5E2_MCL1-01      actggctagttaaacaaagaggctgggatgggtttgtggagttc------
A0A2K5R5E2_MCL1-04      actggctagttaaacaaagaggctgggatgggtttgtggagttc------
A0A2K5Q6R6_BCL2L1-      ----------------aagggccag-gagcgcttc---------------
A0A2K5Q6R6_BCL2L1-      ----------------aagggccag-gagcgcttc---------------
A0A2K5Q6R6_BCL2L1-      ----------------aagggccag-gagcgcttc---------------
A0A2K5RUN8_BCL2L2-      atagagttctcagacaaagagtcagtgaggacttccttggccttagacga
A0A2K5RUN8_BCL2L2-      atagagttctcagacaaagagtcagtgaggacttccttggccttagacga
A0A2K5RUN8_BCL2L2-      atagagttctcagacaaagagtcagtgaggacttccttggccttagacga
A0A2K5RUN8_BCL2L2-      ------------------gcatcagtgagga-------------------
A0A2K5RUN8_BCL2L2-      ------------------gcatcagtgagga-------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5R5E2_MCL1-02      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-01      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      gtccctatttagaggaaggcaaatcaaggt--------------------
A0A2K5RUN8_BCL2L2-      gtccctatttagaggaaggcaaatcaaggt--------------------
A0A2K5RUN8_BCL2L2-      gtccctatttagaggaaggcaaatcaaggttgacgttaaggctttcattt
A0A2K5RUN8_BCL2L2-      ------------------------cagtgctgac----------------
A0A2K5RUN8_BCL2L2-      ------------------------cagtgctgac----------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5PP81_BCL2-01      --------------------------------------------------
A0A2K5R5E2_MCL1-02      ---------------------------------------ttccatgtaga
A0A2K5R5E2_MCL1-03      ---------------------------------------ttccatgtaga
A0A2K5R5E2_MCL1-01      ---------------------------------------ttccatgtaga
A0A2K5R5E2_MCL1-04      ---------------------------------------ttccatgtaga
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      -------------------gatcccaaaacgaaccaacagaccaggcatc
A0A2K5RUN8_BCL2L2-      -------------------gatcccaaaacgaaccaacagaccaggcatc
A0A2K5RUN8_BCL2L2-      attcatctctgactcaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5RIU7_BCL2L10      ---------aacagcagcattcatc-----tacttctggacacgataat-
A0A2K5PP81_BCL2-01      ---------ggtgggagcttgcatca------------------------
A0A2K5R5E2_MCL1-02      ggacctagaaggtggagattgcagtgatcatgccactgtgc---------
A0A2K5R5E2_MCL1-03      ggacctagaaggtggcatcagaaatg----tgctgctg-gc---------
A0A2K5R5E2_MCL1-01      ggacctagaaggtggcatcagaaatg----tgctgctg-gc---------
A0A2K5R5E2_MCL1-04      ggacctagaaggtggcatcagaaatg----tgctgctg-gc---------
A0A2K5Q6R6_BCL2L1-      ---------aaccgctggttcc-----------tgacgggcatg------
A0A2K5Q6R6_BCL2L1-      ---------aaccgctggttcc-----------tgacgggcatg------
A0A2K5Q6R6_BCL2L1-      ---------aaccgctggttcc-----------tgacgggcatg------
A0A2K5RUN8_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgggcacggaccac
A0A2K5RUN8_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgggcacggaccac
A0A2K5RUN8_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgggcacggaccac
A0A2K5RUN8_BCL2L2-      ------aggggccgtgg----------------cactggg----------
A0A2K5RUN8_BCL2L2-      ------aggggccgtgg----------------cactggg----------
                                                                          

A0A2K5PYQ3_BCL2A1-      -------------------------------------------aaagatc
A0A2K5PYQ3_BCL2A1-      -------------------------------------------aaatggc
A0A2K5RIU7_BCL2L10      --------------------------------------------------
A0A2K5PP81_BCL2-01      -------------------------------------------------c
A0A2K5R5E2_MCL1-02      -------------------------------------tccagc-------
A0A2K5R5E2_MCL1-03      -------------------------------------ttttgcaggtgtt
A0A2K5R5E2_MCL1-01      -------------------------------------ttttgcaggtgtt
A0A2K5R5E2_MCL1-04      -------------------------------------ttttgcaggtgtt
A0A2K5Q6R6_BCL2L1-      -----------------------------actgtgg--------------
A0A2K5Q6R6_BCL2L1-      -----------------------------actgtgg--------------
A0A2K5Q6R6_BCL2L1-      -----------------------------actgtgg--------------
A0A2K5RUN8_BCL2L2-      caactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A2K5RUN8_BCL2L2-      caactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A2K5RUN8_BCL2L2-      caactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A2K5RUN8_BCL2L2-      -----------------------------------------------ggc
A0A2K5RUN8_BCL2L2-      -----------------------------------------------ggc
                                                                          

A0A2K5PYQ3_BCL2A1-      tgtgaaatgctatctctcttgaag--------------------------
A0A2K5PYQ3_BCL2A1-      tttgtaa-------------------------------------------
A0A2K5RIU7_BCL2L10      -taggagttttaaaatttttagcc---------------cacttctacct
A0A2K5PP81_BCL2-01      cctgg----gtgcctatctgggcc--------------------------
A0A2K5R5E2_MCL1-02      -ctggcaacagagcgagatt--cc-----------------------ttc
A0A2K5R5E2_MCL1-03      gctggagtaggagctggtttggca-----------------------tat
A0A2K5R5E2_MCL1-01      gctggagtaggagctggtttggca-----------------------tat
A0A2K5R5E2_MCL1-04      gctggagtaggagctggtttggca-----------------------tat
A0A2K5Q6R6_BCL2L1-      -ccggcgtggt-tctgctgggctc-------------------actcttt
A0A2K5Q6R6_BCL2L1-      -ccggcgtggt-tctgctgggctc-------------------actcttt
A0A2K5Q6R6_BCL2L1-      -ccggcgtggt-tctgctgggctc-------------------actcttt
A0A2K5RUN8_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2K5RUN8_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2K5RUN8_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2K5RUN8_BCL2L2-      cctg-----gtaactgtaggggcc--------------------tttttt
A0A2K5RUN8_BCL2L2-      cctg-----gtaactgtaggggcc--------------------tttttt
                           *                                              

A0A2K5PYQ3_BCL2A1-      caatactattga-----------
A0A2K5PYQ3_BCL2A1-      -----------------------
A0A2K5RIU7_BCL2L10      gcccaactgtga-----------
A0A2K5PP81_BCL2-01      ----acaaatga-----------
A0A2K5R5E2_MCL1-02      tcaaaaaaagaaaaaggagctga
A0A2K5R5E2_MCL1-03      ctaataagatagccttgtaa---
A0A2K5R5E2_MCL1-01      ctaataagatag-----------
A0A2K5R5E2_MCL1-04      ctaataagatag-----------
A0A2K5Q6R6_BCL2L1-      agtcggaaatga-----------
A0A2K5Q6R6_BCL2L1-      agtcggaaatga-----------
A0A2K5Q6R6_BCL2L1-      agtcggaaatga-----------
A0A2K5RUN8_BCL2L2-      ccttac---taa-----------
A0A2K5RUN8_BCL2L2-      ccttac---taa-----------
A0A2K5RUN8_BCL2L2-      ccttac---taa-----------
A0A2K5RUN8_BCL2L2-      gctagcaagtga-----------
A0A2K5RUN8_BCL2L2-      gctagcaagtga-----------
                                               

© 1998-2020Legal notice