Dataset for CDS BCL2L2 of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5RUN8_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K5RUN8_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt

A0A2K5RUN8_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2K5RUN8_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg

A0A2K5RUN8_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctgga
A0A2K5RUN8_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctgga

A0A2K5RUN8_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K5RUN8_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca

A0A2K5RUN8_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
A0A2K5RUN8_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg

A0A2K5RUN8_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K5RUN8_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt

A0A2K5RUN8_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K5RUN8_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc

A0A2K5RUN8_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K5RUN8_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc

A0A2K5RUN8_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagctatcaaa
A0A2K5RUN8_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
                        ********************************* *      *   *** *

A0A2K5RUN8_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggaactaca
A0A2K5RUN8_BCL2L2-      gctctatacgggg-------------------------------------
                        **** *  * ***                                     

A0A2K5RUN8_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctg
A0A2K5RUN8_BCL2L2-      --acgggg------------------------------------------
                          *** **                                          

A0A2K5RUN8_BCL2L2-      gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcc
A0A2K5RUN8_BCL2L2-      ---------------ccctggaggaggcg-cggcgtctg-----------
                                       ** * ******  *  ** * ***           

A0A2K5RUN8_BCL2L2-      atctatgttggcaatgtggactacggtgcaacagcagaagagctggaagc
A0A2K5RUN8_BCL2L2-      -------------------------------cgggaggggaactgg----
                                                       * * **  ** ****    

A0A2K5RUN8_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca
A0A2K5RUN8_BCL2L2-      --------------------------------------------------

A0A2K5RUN8_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A2K5RUN8_BCL2L2-      --------------------------------------------------

A0A2K5RUN8_BCL2L2-      gagtcagtgaggacttccttggccttagacgagtccctatttagaggaag
A0A2K5RUN8_BCL2L2-      gcatcagtgagga-------------------------------------
                        *  **********                                     

A0A2K5RUN8_BCL2L2-      gcaaatcaaggttgacgttaaggctttcatttattcatctctgactcagg
A0A2K5RUN8_BCL2L2-      ------cagtgctgac----------------------------------
                              **  * ****                                  

A0A2K5RUN8_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggt
A0A2K5RUN8_BCL2L2-      --------------------------------------aggggccgtgg-
                                                              *  * *** ** 

A0A2K5RUN8_BCL2L2-      tttccacgagcccgctaccgggcacggaccaccaactacaacagttcccg
A0A2K5RUN8_BCL2L2-      ---------------cactggg----------------------------
                                        ** ***                            

A0A2K5RUN8_BCL2L2-      ctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
A0A2K5RUN8_BCL2L2-      -----------------------------ggccctg-----gtaactgta
                                                     ***** *     *   **  *

A0A2K5RUN8_BCL2L2-      ggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5RUN8_BCL2L2-      ggggcc--------------------ttttttgctagcaagtga
                        ******                    * **   **  *   * *

© 1998-2020Legal notice