Dataset for CDS MCL-1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2D770_MCL1-01      ------------atgttcggcctcaagagaaacgcagtaatcggactaaa
A5PJR2_MCL1-01          ------------atgttcggcctcaagagaaacgcagtaatcggactaaa
A0A4W2D770_MCL1-02      ------------atgttcggcctcaagagaaacgcagtaatcggactaaa
F1MQX4_MCL1-01          ggaatgttgccaatattt--------------------------------
A0A4W2CQV1_MCL1-01      ------------atgtgt--------------------------------
A0A4W2G6Q5_MCL1-01      ------------atgtgt--------------------------------
                                    ** *                                  

A0A4W2D770_MCL1-01      cctctattgtgggggagccggattaggacagggcagcggcgcctcctctc
A5PJR2_MCL1-01          cctctattgtgggggagccggattaggacagggcagcggcgcctcctctc
A0A4W2D770_MCL1-02      cctctattgtgggggagccggattaggacagggcagcggcgcctcctctc
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      cgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagag
A5PJR2_MCL1-01          cgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagag
A0A4W2D770_MCL1-02      cgggggggcggctttt----------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      gtagggggaggggaagccggcacggtgattggcggaagcgccggcccgag
A5PJR2_MCL1-01          gtagggggaggggaagccggcacggtgattggcggaagcgccggcccgag
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      ccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgc
A5PJR2_MCL1-01          ccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      ccattggcgccgagggccccgacgtcaccgcgacccccaccagactgctg
A5PJR2_MCL1-01          ccattggcgccgagggccccgacgtcaccgcgacccccaccagactgctg
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      ttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcccc
A5PJR2_MCL1-01          ttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcccc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      gatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagc
A5PJR2_MCL1-01          gatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      cagaccctctcgggaagcggcctgccgtccggcctttacctttgttggtc
A5PJR2_MCL1-01          cagaccctctcgggaagcggcctgccgtccggcctttacctttgttggtc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      ggagaagccagtaacaacagtccaggctcggacggctcgctgccctcgac
A5PJR2_MCL1-01          ggagaagccagtaacaacagtccaggctcggacggctcgctgccctcgac
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      gccgcccccagcagaggaggaggaggacgagttatatcggcagtccctgg
A5PJR2_MCL1-01          gccgcccccagcagaggaggaggaggacgagttatatcggcagtccctgg
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          ----------tcagaggaggaggaggacgagttatattggcagtccctgg
A0A4W2CQV1_MCL1-01      -------------gaggaggaggaggacgagttatattggcagtccctgg
A0A4W2G6Q5_MCL1-01      -------------gaggaggaggaggacgagttatattggcagtccctgg

A0A4W2D770_MCL1-01      agataatctctcagtacctccgggagcaggcaaccggcgccaaggacgcg
A5PJR2_MCL1-01          agataatctctcagtacctccgggagcaggcaaccggcgccaaggacgcg
A0A4W2D770_MCL1-02      ----------------------------ggcaaccggcgccaaggacgcg
F1MQX4_MCL1-01          agattatctctcggtacctccgggagcaggcaaccggcgccaaggatgtg
A0A4W2CQV1_MCL1-01      agattatctctcggtacctccgggagcaggcaaccggcgccaaggatgtg
A0A4W2G6Q5_MCL1-01      agattatctctcggtacctccgggagcaggcaaccggcgccaaggatgtg
                                                    ****************** * *

A0A4W2D770_MCL1-01      aagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccct
A5PJR2_MCL1-01          aagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccct
A0A4W2D770_MCL1-02      aagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccct
F1MQX4_MCL1-01          aagcccctgggcgggtctggggccaccagccggaaggcgttggagaccct
A0A4W2CQV1_MCL1-01      aagcccctgggcaggtctggggccaccagccggaaggcgttggagaccct
A0A4W2G6Q5_MCL1-01      aagcccctgggcgggtctggggccaccagccggaaggcgttggagaccct
                        ************ ******** **** ***********************

A0A4W2D770_MCL1-01      gcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaag
A5PJR2_MCL1-01          gcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaag
A0A4W2D770_MCL1-02      gcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaag
F1MQX4_MCL1-01          gcaccgagtcggggatggggtgcagcacaaccacgagacggctttccaag
A0A4W2CQV1_MCL1-01      gcaccgagtcggggatggggtgcagcacaaccacgagacggctttccaag
A0A4W2G6Q5_MCL1-01      gcaccgagtcggggatggggtgcagcacaaccacgagacggctttccaag
                        ** *********************** ***********************

A0A4W2D770_MCL1-01      gcatgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttg
A5PJR2_MCL1-01          gcatgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttg
A0A4W2D770_MCL1-02      gcatgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttg
F1MQX4_MCL1-01          gcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatctttg
A0A4W2CQV1_MCL1-01      gcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatctttg
A0A4W2G6Q5_MCL1-01      gcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatctttg
                        ********* ****************** *********** *********

A0A4W2D770_MCL1-01      tctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcag
A5PJR2_MCL1-01          tctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcag
A0A4W2D770_MCL1-02      tctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcag
F1MQX4_MCL1-01          tctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcag
A0A4W2CQV1_MCL1-01      tctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcag
A0A4W2G6Q5_MCL1-01      tctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcag
                        ****************************** *******************

A0A4W2D770_MCL1-01      gattgtgactcttatttcttttggtgcctttgtggccaaacacttgaaga
A5PJR2_MCL1-01          gattgtgactcttatttcttttggtgcctttgtggccaaacacttgaaga
A0A4W2D770_MCL1-02      gattgtgactcttatttcttttggtgcctttgtggccaaacacttgaaga
F1MQX4_MCL1-01          gattgtgactcttatttcttttggtgcctttgtggccaaacactttaaga
A0A4W2CQV1_MCL1-01      gattgtgactcttatttcttttggtgcctttgtggccaaacactttaaga
A0A4W2G6Q5_MCL1-01      gattgtgactcttatttcttttggtgcctttgtggccaaacactttaaga
                        ********************************************* ****

A0A4W2D770_MCL1-01      gtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagat
A5PJR2_MCL1-01          gtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagat
A0A4W2D770_MCL1-02      gtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagat
F1MQX4_MCL1-01          gtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagat
A0A4W2CQV1_MCL1-01      gtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagat
A0A4W2G6Q5_MCL1-01      gtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagat

A0A4W2D770_MCL1-01      gttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctggga
A5PJR2_MCL1-01          gttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctggga
A0A4W2D770_MCL1-02      gttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctggga
F1MQX4_MCL1-01          gttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctggga
A0A4W2CQV1_MCL1-01      gttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctggga
A0A4W2G6Q5_MCL1-01      gttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctggga
                        ************************************ *************

A0A4W2D770_MCL1-01      tgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa
A5PJR2_MCL1-01          tgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa
A0A4W2D770_MCL1-02      tgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa
F1MQX4_MCL1-01          tgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa
A0A4W2CQV1_MCL1-01      tgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa
A0A4W2G6Q5_MCL1-01      tgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa

A0A4W2D770_MCL1-01      atgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggca
A5PJR2_MCL1-01          atgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggca
A0A4W2D770_MCL1-02      atgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggca
F1MQX4_MCL1-01          atgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggca
A0A4W2CQV1_MCL1-01      atgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggca
A0A4W2G6Q5_MCL1-01      atgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggca

A0A4W2D770_MCL1-01      tatctaataagatag
A5PJR2_MCL1-01          tatctaataagatag
A0A4W2D770_MCL1-02      tatctaataagatag
F1MQX4_MCL1-01          tatctaataagatag
A0A4W2CQV1_MCL1-01      tatctaataagatag
A0A4W2G6Q5_MCL1-01      tatctaataagatag

© 1998-2022Legal notice