Dataset for CDS MCL-1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2D770_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
A0A4W2D770_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
A0A4W2CQV1_MCL1-01      atg------------------------------------------tgtga
A0A4W2G6Q5_MCL1-01      atg------------------------------------------tgtga
                        ***                                          **** 

A0A4W2D770_MCL1-01      gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
A0A4W2D770_MCL1-02      gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
A0A4W2CQV1_MCL1-01      gg------------------------------------------------
A0A4W2G6Q5_MCL1-01      gg------------------------------------------------

A0A4W2D770_MCL1-01      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A4W2D770_MCL1-02      tttt----------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagt
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccagc
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------

A0A4W2D770_MCL1-01      agaggaggaggaggacgagttatatcggcagtccctggagataatctctc
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      -----aggaggaggacgagttatattggcagtccctggagattatctctc
A0A4W2G6Q5_MCL1-01      -----aggaggaggacgagttatattggcagtccctggagattatctctc

A0A4W2D770_MCL1-01      agtacctccgggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A4W2D770_MCL1-02      ----------------ggcaaccggcgccaaggacgcgaagcccctgggc
A0A4W2CQV1_MCL1-01      ggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccctgggc
A0A4W2G6Q5_MCL1-01      ggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccctgggc
                                        ****************** * *************

A0A4W2D770_MCL1-01      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcgg
A0A4W2D770_MCL1-02      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcgg
A0A4W2CQV1_MCL1-01      aggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcgg
A0A4W2G6Q5_MCL1-01      gggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcgg
                         ******** **** ************************* *********

A0A4W2D770_MCL1-01      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A4W2D770_MCL1-02      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A4W2CQV1_MCL1-01      ggatggggtgcagcacaaccacgagacggctttccaaggcatgcttcaga
A0A4W2G6Q5_MCL1-01      ggatggggtgcagcacaaccacgagacggctttccaaggcatgcttcaga
                        ************** ******************************** **

A0A4W2D770_MCL1-01      aactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatg
A0A4W2D770_MCL1-02      aactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatg
A0A4W2CQV1_MCL1-01      aactggacatcaaaaacgaagacgatgttaaatctttgtctcgagtgatg
A0A4W2G6Q5_MCL1-01      aactggacatcaaaaacgaagacgatgttaaatctttgtctcgagtgatg
                        **************** *********** *********************

A0A4W2D770_MCL1-01      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A4W2D770_MCL1-02      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A4W2CQV1_MCL1-01      gttcatgttttcagtgacagagtaacaaactggggcaggattgtgactct
A0A4W2G6Q5_MCL1-01      gttcatgttttcagtgacagagtaacaaactggggcaggattgtgactct
                        ****************** *******************************

A0A4W2D770_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A4W2D770_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A4W2CQV1_MCL1-01      tatttcttttggtgcctttgtggccaaacactttaagagtataaatcaag
A0A4W2G6Q5_MCL1-01      tatttcttttggtgcctttgtggccaaacactttaagagtataaatcaag
                        ********************************* ****************

A0A4W2D770_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A4W2D770_MCL1-02      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A4W2CQV1_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A4W2G6Q5_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg

A0A4W2D770_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A4W2D770_MCL1-02      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A4W2CQV1_MCL1-01      tcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtgga
A0A4W2G6Q5_MCL1-01      tcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtgga
                        ************************ *************************

A0A4W2D770_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A4W2D770_MCL1-02      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A4W2CQV1_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A4W2G6Q5_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg

A0A4W2D770_MCL1-01      cttttgcaggtgttgccggagtaggagctggtttggcatatctaataaga
A0A4W2D770_MCL1-02      cttttgcaggtgttgccggagtaggagctggtttggcatatctaataaga
A0A4W2CQV1_MCL1-01      cttttgcaggtgttgccggagtaggagctggtttggcatatctaataaga
A0A4W2G6Q5_MCL1-01      cttttgcaggtgttgccggagtaggagctggtttggcatatctaataaga

A0A4W2D770_MCL1-01      tag
A0A4W2D770_MCL1-02      tag
A0A4W2CQV1_MCL1-01      tag
A0A4W2G6Q5_MCL1-01      tag

© 1998-2022Legal notice