Dataset for CDS BCL2L10 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2EB77_BCL2L10      ---------------------atggtggacccgtttagggagcgcaccgc
E1B9B3_BCL2L10-01       atgactga---aggcggagccatggtggacccgtttagggagcgcaccgc
F1MV39_BCL2L10-01       gttgctgatggacaggaaagcctggt------------ggagcgcaccgc
A0A4W2C0F3_BCL2L10      tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgc
A0A4W2FG99_BCL2L10      tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgc
                                              ****            ************

A0A4W2EB77_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
E1B9B3_BCL2L10-01       ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
F1MV39_BCL2L10-01       ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
A0A4W2C0F3_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
A0A4W2FG99_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
                        **************************************************

A0A4W2EB77_BCL2L10      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
E1B9B3_BCL2L10-01       cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
F1MV39_BCL2L10-01       cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
A0A4W2C0F3_BCL2L10      cagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
A0A4W2FG99_BCL2L10      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
                        *** **********************************************

A0A4W2EB77_BCL2L10      gcacgtatccaggaagcaaatcgaaacgtcttgcccctataccgccgctg
E1B9B3_BCL2L10-01       gcacgtatccaggaagcaaatcgaaacgtcttgcccctataccgccgctg
F1MV39_BCL2L10-01       gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
A0A4W2C0F3_BCL2L10      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
A0A4W2FG99_BCL2L10      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
                        ************************** ***********************

A0A4W2EB77_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
E1B9B3_BCL2L10-01       ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
F1MV39_BCL2L10-01       ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
A0A4W2C0F3_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
A0A4W2FG99_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
                        **************************************************

A0A4W2EB77_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtaaccttc
E1B9B3_BCL2L10-01       acgaagaccctggccccagctggggccgcgtggcctcactcgtaaccttc
F1MV39_BCL2L10-01       acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
A0A4W2C0F3_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
A0A4W2FG99_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
                        ******************************************* ******

A0A4W2EB77_BCL2L10      gcggggtcgctgctggagaggccaccgcagacgacccgacggcaggagaa
E1B9B3_BCL2L10-01       gcggggtcgctgctggagaggccaccgcagacgacccgacggcaggagaa
F1MV39_BCL2L10-01       gcggggtcgctgctggagaggccgccgcagactacccgacggc---agaa
A0A4W2C0F3_BCL2L10      gcggggtcgctgctggagaggccgccgcagactacccgacggc---agaa
A0A4W2FG99_BCL2L10      gcggggtcgctgctggagaggccgccgcagactacccgacggc---agaa
                        *********************** ******** **********   ****

A0A4W2EB77_BCL2L10      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
E1B9B3_BCL2L10-01       gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
F1MV39_BCL2L10-01       gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
A0A4W2C0F3_BCL2L10      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
A0A4W2FG99_BCL2L10      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
                        **************************************************

A0A4W2EB77_BCL2L10      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatgactaacggc
E1B9B3_BCL2L10-01       tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatgactaacggc
F1MV39_BCL2L10-01       tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggc
A0A4W2C0F3_BCL2L10      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggc
A0A4W2FG99_BCL2L10      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggc
                        ***************************************** ********

A0A4W2EB77_BCL2L10      ggctg---------------------------------------------
E1B9B3_BCL2L10-01       ggctgggtgagcgcgaaggacgcggggctggtgggcagcctgggacgcgc
F1MV39_BCL2L10-01       ggctg---------------------------------------------
A0A4W2C0F3_BCL2L10      ggctg---------------------------------------------
A0A4W2FG99_BCL2L10      ggctg---------------------------------------------
                        *****                                             

A0A4W2EB77_BCL2L10      ----------ggatggattttgtctcttcttc--ccactcattcca-cca
E1B9B3_BCL2L10-01       ccacgctgccggatggattttgtctcttcttcagccactcattccagcca
F1MV39_BCL2L10-01       ----------ggatggattttgtctctttttcagccagtcattccagcca
A0A4W2C0F3_BCL2L10      ----------ggatggattttgtctctttttcagccagtcattccagcca
A0A4W2FG99_BCL2L10      ----------ggatggattttgtctctttttcagccagtcattccagcca
                                  ****************** ***  *** ******** ***

A0A4W2EB77_BCL2L10      tcttgggaaagacagctggtctggtttttcctctcatactggacagcaat
E1B9B3_BCL2L10-01       tcttgggaaagacagctggtctggtttttcctctcatactggacagcaat
F1MV39_BCL2L10-01       tcttgggaaagacagctggtctggtttttcctcgcatactggacagcaat
A0A4W2C0F3_BCL2L10      tcttgggaaagacagctggtctggtttttcctcgcatactggacagcaat
A0A4W2FG99_BCL2L10      tcttgggaaagacagctggtctggtttttcctcgcatactggacagcaat
                        ********************************* ****************

A0A4W2EB77_BCL2L10      aatcataatctacttctggataaaattatcgtga----------------
E1B9B3_BCL2L10-01       aatcataatctacttctggataaaattatcgtgagttctaaaattcttat
F1MV39_BCL2L10-01       aatcataatctacttctggataaaattattgtga----------------
A0A4W2C0F3_BCL2L10      aatcataatctacttctggataaaattattgtga----------------
A0A4W2FG99_BCL2L10      aatcataatctacttctggataaaattattgtga----------------
                        ***************************** ****                

A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       ttctacctgcctaactctgagcaaccaagcaaaattgaaatgtgaaagac
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
                                                                          

A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       caaatcagagtaaaccaccttccgagacatttttatctgcattcatgtaa
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
                                                                          

© 1998-2021Legal notice