Dataset for CDS BCL2L10 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E1B9B3_BCL2L10-01      atgactgaaggc---ggagccatggtggacccgtttagggagcgcaccgc
F1MV39_BCL2L10-01      gttgctgatggacaggaaagcctggt------------ggagcgcaccgc
                        *  **** **    * *  * ****            ************

E1B9B3_BCL2L10-01      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
F1MV39_BCL2L10-01      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc

E1B9B3_BCL2L10-01      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
F1MV39_BCL2L10-01      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc

E1B9B3_BCL2L10-01      gcacgtatccaggaagcaaatcgaaacgtcttgcccctataccgccgctg
F1MV39_BCL2L10-01      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
                       ************************** ***********************

E1B9B3_BCL2L10-01      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
F1MV39_BCL2L10-01      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg

E1B9B3_BCL2L10-01      acgaagaccctggccccagctggggccgcgtggcctcactcgtaaccttc
F1MV39_BCL2L10-01      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
                       ******************************************* ******

E1B9B3_BCL2L10-01      gcggggtcgctgctggagaggccaccgcagacgacccgacggcaggagaa
F1MV39_BCL2L10-01      gcggggtcgctgctggagaggccgccgcagactacccgacggc---agaa
                       *********************** ******** **********   ****

E1B9B3_BCL2L10-01      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
F1MV39_BCL2L10-01      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc

E1B9B3_BCL2L10-01      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatgactaacggc
F1MV39_BCL2L10-01      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggc
                       ***************************************** ********

E1B9B3_BCL2L10-01      ggctgggtgagcgcgaaggacgcggggctggtgggcagcctgggacgcgc
F1MV39_BCL2L10-01      ggctg---------------------------------------------

E1B9B3_BCL2L10-01      ccacgctgccggatggattttgtctcttcttcagccactcattccagcca
F1MV39_BCL2L10-01      ----------ggatggattttgtctctttttcagccagtcattccagcca
                                 ****************** ******** ************

E1B9B3_BCL2L10-01      tcttgggaaagacagctggtctggtttttcctctcatactggacagcaat
F1MV39_BCL2L10-01      tcttgggaaagacagctggtctggtttttcctcgcatactggacagcaat
                       ********************************* ****************

E1B9B3_BCL2L10-01      aatcataatctacttctggataaaattatcgtgagttctaaaattcttat
F1MV39_BCL2L10-01      aatcataatctacttctggataaaattattgtga----------------
                       ***************************** ****                

E1B9B3_BCL2L10-01      ttctacctgcctaactctgagcaaccaagcaaaattgaaatgtgaaagac
F1MV39_BCL2L10-01      --------------------------------------------------

E1B9B3_BCL2L10-01      caaatcagagtaaaccaccttccgagacatttttatctgcattcatgtaa
F1MV39_BCL2L10-01      --------------------------------------------------

© 1998-2020Legal notice