Dataset for CDS BCL2L10 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2EB77_BCL2L10      ---------------------atggtggacccgtttagggagcgcaccgc
A0A4W2C0F3_BCL2L10      tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgc
A0A4W2FG99_BCL2L10      tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgc

A0A4W2EB77_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
A0A4W2C0F3_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
A0A4W2FG99_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc

A0A4W2EB77_BCL2L10      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
A0A4W2C0F3_BCL2L10      cagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
A0A4W2FG99_BCL2L10      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
                        *** **********************************************

A0A4W2EB77_BCL2L10      gcacgtatccaggaagcaaatcgaaacgtcttgcccctataccgccgctg
A0A4W2C0F3_BCL2L10      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
A0A4W2FG99_BCL2L10      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
                        ************************** ***********************

A0A4W2EB77_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
A0A4W2C0F3_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
A0A4W2FG99_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg

A0A4W2EB77_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtaaccttc
A0A4W2C0F3_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
A0A4W2FG99_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
                        ******************************************* ******

A0A4W2EB77_BCL2L10      gcggggtcgctgctggagaggccaccgcagacgacccgacggcaggagaa
A0A4W2C0F3_BCL2L10      gcggggtcgctgctggagaggccgccgcagactacccgacggc---agaa
A0A4W2FG99_BCL2L10      gcggggtcgctgctggagaggccgccgcagactacccgacggc---agaa
                        *********************** ******** **********   ****

A0A4W2EB77_BCL2L10      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
A0A4W2C0F3_BCL2L10      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc
A0A4W2FG99_BCL2L10      gagagacgacgacggcgttagcagggactgtcggctcctggtggcccttc

A0A4W2EB77_BCL2L10      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatgactaacggc
A0A4W2C0F3_BCL2L10      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggc
A0A4W2FG99_BCL2L10      tgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggc
                        ***************************************** ********

A0A4W2EB77_BCL2L10      ggctgggatggattttgtctcttcttc--ccactcattcca-ccatcttg
A0A4W2C0F3_BCL2L10      ggctgggatggattttgtctctttttcagccagtcattccagccatcttg
A0A4W2FG99_BCL2L10      ggctgggatggattttgtctctttttcagccagtcattccagccatcttg
                        *********************** ***  *** ******** ********

A0A4W2EB77_BCL2L10      ggaaagacagctggtctggtttttcctctcatactggacagcaataatca
A0A4W2C0F3_BCL2L10      ggaaagacagctggtctggtttttcctcgcatactggacagcaataatca
A0A4W2FG99_BCL2L10      ggaaagacagctggtctggtttttcctcgcatactggacagcaataatca
                        **************************** *********************

A0A4W2EB77_BCL2L10      taatctacttctggataaaattatcgtga
A0A4W2C0F3_BCL2L10      taatctacttctggataaaattattgtga
A0A4W2FG99_BCL2L10      taatctacttctggataaaattattgtga
                        ************************ ****

© 1998-2022Legal notice