Dataset for CDS BCL2L1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2GX13_BCL2L1-      atgtctcagagtaaccgggagctggtggttgactttctctcttacaagct
Q05KJ0_BCL2L1-01        atgtctcagagtaaccgggagctggtggttgactttctctcttacaagct
Q05KJ0_BCL2L1-02        atgtctcagagtaaccgggagctggtggttgactttctctcttacaagct
A0A3Q1LRT3_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
A0A4W2D608_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
A0A4W2F845_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
                        *********** ** ***** ** **************************

A0A4W2GX13_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q05KJ0_BCL2L1-01        ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q05KJ0_BCL2L1-02        ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A3Q1LRT3_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgt------------ca
A0A4W2D608_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtggtatgaaagaacaca
A0A4W2F845_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgt------------ca
                        ***********************************             **

A0A4W2GX13_BCL2L1-      gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
Q05KJ0_BCL2L1-01        gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
Q05KJ0_BCL2L1-02        gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
A0A3Q1LRT3_BCL2L1-      gatatggaaacccccagtgga-----tcag---tggcaacc---------
A0A4W2D608_BCL2L1-      gaactgagaccccagaagggagagagtcagatatggaaacc---------
A0A4W2F845_BCL2L1-      gatatggaaacccccagtgga-----tcag---tggcaacc---------
                        **  **    ***  *  ***     ****   *** ****         

A0A4W2GX13_BCL2L1-      atcaatggcaacgcatcctggcacctggcggatagccctgctgtgaatgg
Q05KJ0_BCL2L1-01        atcaatggcaacgcatcctggcacctggcggatagccctgctgtgaatgg
Q05KJ0_BCL2L1-02        atcaatggcaacgcatcctggcacctggcggatagccctgctgtgaatgg
A0A3Q1LRT3_BCL2L1-      -------------catcctggcacctggcagatagccccacagtgaatgg
A0A4W2D608_BCL2L1-      -------------c--------------ccaatagccccacagtgaatgg
A0A4W2F845_BCL2L1-      -------------catcctggcacctggcagatagccccacagtgaatgg
                                     *              *  *******  * ********

A0A4W2GX13_BCL2L1-      agccactggccacagcagaagctcggatgcccgggaagtgatccccatgg
Q05KJ0_BCL2L1-01        agccactggccacagcagaagctcggatgcccgggaagtgatccccatgg
Q05KJ0_BCL2L1-02        agccactggccacagcagaagctcggatgcccgggaagtgatccccatgg
A0A3Q1LRT3_BCL2L1-      agccactggccacagcagaagcttggatgcccggaaaatgatccccatga
A0A4W2D608_BCL2L1-      agccactggccacagcagaagcttggatgcccggaaaatgatccccatga
A0A4W2F845_BCL2L1-      agccactggccacagcagaagcttggatgcccggaaaatgatccccatga
                        *********************** ********** ** *********** 

A0A4W2GX13_BCL2L1-      cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
Q05KJ0_BCL2L1-01        cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
Q05KJ0_BCL2L1-02        cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
A0A3Q1LRT3_BCL2L1-      caacagtaaagcaagccctgagggaggcaagcaatgagtttaaactgagg
A0A4W2D608_BCL2L1-      caacagtaaagcaagccctgagggaggcaagcaatgagtttaaactttgg
A0A4W2F845_BCL2L1-      caacagtaaagcaagccctgagggaggcaagcaatgagtttaaactgagg
                        ** * ** ********************* ** ******** ****  **

A0A4W2GX13_BCL2L1-      taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
Q05KJ0_BCL2L1-01        taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
Q05KJ0_BCL2L1-02        taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
A0A3Q1LRT3_BCL2L1-      taccaacagacattcagcgacctgatgtcccagctccgcatcaccccagg
A0A4W2D608_BCL2L1-      taccaacagacattcagcgacctgacgtcccagctccgcatcaccccagg
A0A4W2F845_BCL2L1-      taccaacagacattcagcgacctgatgtcccagctccgcatcaccccagg
                        **** ** * *************** *********** ************

A0A4W2GX13_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
Q05KJ0_BCL2L1-01        gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
Q05KJ0_BCL2L1-02        gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
A0A3Q1LRT3_BCL2L1-      gacagcatgtcagagctttgaacaggtaataaatgaactcttccgggaca
A0A4W2D608_BCL2L1-      gacagcatgtcagagctttgaacaggtaataaatgaactcttccgggaca
A0A4W2F845_BCL2L1-      gacagcatgtcagagctttgaacaggtaataaatgaactcttccgggaca
                        ******** ******************* * ****************** 

A0A4W2GX13_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
Q05KJ0_BCL2L1-01        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
Q05KJ0_BCL2L1-02        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A3Q1LRT3_BCL2L1-      gggtgaaatggggtcacgttgtggcctttttctccttcagtgggacacta
A0A4W2D608_BCL2L1-      gggtgaagtggggtcacgttgtggcctttttctccttcagtgggacaata
A0A4W2F845_BCL2L1-      gggtgaagtggggtcacgttgtggcctttttctccttcagtgggacacta
                        ******* ******* * ******************** ***** ** * 

A0A4W2GX13_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q05KJ0_BCL2L1-01        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q05KJ0_BCL2L1-02        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A3Q1LRT3_BCL2L1-      tgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcac
A0A4W2D608_BCL2L1-      tgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcac
A0A4W2F845_BCL2L1-      tgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcac
                        *** ** ***** ************* ** ************* * ** *

A0A4W2GX13_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
Q05KJ0_BCL2L1-01        aacttggatggccacttacctgaatgaccacctagagccttggatccagg
Q05KJ0_BCL2L1-02        aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A3Q1LRT3_BCL2L1-      aacttcaacggccacttacctaaataaccacctcaagccttggatccaag
A0A4W2D608_BCL2L1-      aacttcaatggccacttacctaaataaccacctcaagccttggatccaag
A0A4W2F845_BCL2L1-      aacttcaacggccacttacctaaataaccacctcaagccttggatccaag
                        *****  * ************ *** *******  ************* *

A0A4W2GX13_BCL2L1-      agaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
Q05KJ0_BCL2L1-01        agaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
Q05KJ0_BCL2L1-02        agaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
A0A3Q1LRT3_BCL2L1-      agaacggcgggtgggacacttttgtggaactctacgaaagcaatacaaca
A0A4W2D608_BCL2L1-      agaacggcgggtgggacacttttgtggaactctacgaaagcaatacaaca
A0A4W2F845_BCL2L1-      agaacggcgggtgggacacttttgtggaactctacgaaagcaatacaaca
                        ********** *************************  * **** ** **

A0A4W2GX13_BCL2L1-      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
Q05KJ0_BCL2L1-01        gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
Q05KJ0_BCL2L1-02        gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
A0A3Q1LRT3_BCL2L1-      aacgagagccagaagggccaagagcgtttcaactgctggtccctgac-ga
A0A4W2D608_BCL2L1-      aacgagagccagaagggccaggagcgcttcaact--------ccatt-ta
A0A4W2F845_BCL2L1-      aacgagagccagaagggccaagagtgtttcaact--------ccatt-ta
                          ******** ********* *** * ******         *       

A0A4W2GX13_BCL2L1-      catgactgtggctggtgtggttctgctgggctcgctcttca---------
Q05KJ0_BCL2L1-01        catgactgtggctggtgtggttctgctgggctcgctcttca---------
Q05KJ0_BCL2L1-02        catgactgtggctggtgtggttctgctgggctcgctcttca---------
A0A3Q1LRT3_BCL2L1-      cacgactgtggctgtttggcattttcttaa-------ttaaacatata--
A0A4W2D608_BCL2L1-      cactactgctgctgtcgcaggcctcgcaaacctcatttcaaacacaaaac
A0A4W2F845_BCL2L1-      cactactgctgctgtcgcaggcctcacaaacctcatttcaaacacaaaac
                        **  ****  ****         *             *  *         

A0A4W2GX13_BCL2L1-      ----------------------------------------gtcgg-----
Q05KJ0_BCL2L1-01        ----------------------------------------gtcgg-----
Q05KJ0_BCL2L1-02        ----------------------------------------gtcgg-----
A0A3Q1LRT3_BCL2L1-      tttaccaaacaacccagcaattgtactcttgagcatttatctggg-----
A0A4W2D608_BCL2L1-      tttattcaaaattagaccaaagatgcccata-----ctatgtgggccact
A0A4W2F845_BCL2L1-      tttattcaaaattagaccaaagatgcccata-----ctatgtgggccact
                                                                 * **     

A0A4W2GX13_BCL2L1-      -----------aaatga-----------
Q05KJ0_BCL2L1-01        -----------aaatga-----------
Q05KJ0_BCL2L1-02        -----------aaatga-----------
A0A3Q1LRT3_BCL2L1-      -------agatacgcaacattactgtag
A0A4W2D608_BCL2L1-      caggctcagatagatga-----------
A0A4W2F845_BCL2L1-      caggctcagatagatga-----------
                                   *    *           

© 1998-2022Legal notice