Dataset for CDS BCL2L1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1LRT3_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
Q05KJ0_BCL2L1-02        atgtctcagagtaaccgggagctggtggttgactttctctcttacaagct
Q05KJ0_BCL2L1-01        atgtctcagagtaaccgggagctggtggttgactttctctcttacaagct
                        *********** ** ***** ** **************************

A0A3Q1LRT3_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtg---------------
Q05KJ0_BCL2L1-02        ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q05KJ0_BCL2L1-01        ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca

A0A3Q1LRT3_BCL2L1-      --------------------------tcagatatggaaacccccagtg-g
Q05KJ0_BCL2L1-02        gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
Q05KJ0_BCL2L1-01        gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc

A0A3Q1LRT3_BCL2L1-      atcagtggcaacccatcctggcacctggcagatagccccacagtgaatgg
Q05KJ0_BCL2L1-02        atcaatggcaacgcatcctggcacctggcggatagccctgctgtgaatgg
Q05KJ0_BCL2L1-01        atcaatggcaacgcatcctggcacctggcggatagccctgctgtgaatgg
                        **** ******* **************** ********  * ********

A0A3Q1LRT3_BCL2L1-      agccactggccacagcagaagcttggatgcccggaaaatgatccccatga
Q05KJ0_BCL2L1-02        agccactggccacagcagaagctcggatgcccgggaagtgatccccatgg
Q05KJ0_BCL2L1-01        agccactggccacagcagaagctcggatgcccgggaagtgatccccatgg
                        *********************** ********** ** *********** 

A0A3Q1LRT3_BCL2L1-      caacagtaaagcaagccctgagggaggcaagcaatgagtttaaactgagg
Q05KJ0_BCL2L1-02        cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
Q05KJ0_BCL2L1-01        cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
                        ** * ** ********************* ** ******** ********

A0A3Q1LRT3_BCL2L1-      taccaacagacattcagcgacctgatgtcccagctccgcatcaccccagg
Q05KJ0_BCL2L1-02        taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
Q05KJ0_BCL2L1-01        taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
                        **** ** * *************** *********** ************

A0A3Q1LRT3_BCL2L1-      gacagcatgtcagagctttgaacaggtaataaatgaactcttccgggaca
Q05KJ0_BCL2L1-02        gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
Q05KJ0_BCL2L1-01        gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
                        ******** ******************* * ****************** 

A0A3Q1LRT3_BCL2L1-      gggtgaaatggggtcacgttgtggcctttttctccttcagtgggacacta
Q05KJ0_BCL2L1-02        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
Q05KJ0_BCL2L1-01        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                        ******* ******* * ******************** ***** **** 

A0A3Q1LRT3_BCL2L1-      tgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcac
Q05KJ0_BCL2L1-02        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q05KJ0_BCL2L1-01        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        *** ** ***** ************* ** ************* * ** *

A0A3Q1LRT3_BCL2L1-      aacttcaacggccacttacctaaataaccacctcaagccttggatccaag
Q05KJ0_BCL2L1-02        aacttggatggccacttacctgaatgaccacctagagccttggatccagg
Q05KJ0_BCL2L1-01        aacttggatggccacttacctgaatgaccacctagagccttggatccagg
                        *****  * ************ *** *******  ************* *

A0A3Q1LRT3_BCL2L1-      agaacggcgggtgggacacttttgtggaactctacgaaagcaatacaaca
Q05KJ0_BCL2L1-02        agaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
Q05KJ0_BCL2L1-01        agaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
                        ********** *************************  * **** ** **

A0A3Q1LRT3_BCL2L1-      aacgagagccagaagggccaagagcgtttcaactgctggtccctgac-ga
Q05KJ0_BCL2L1-02        gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
Q05KJ0_BCL2L1-01        gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
                          ******** ********* ***** ****** ****** ****** * 

A0A3Q1LRT3_BCL2L1-      cacgactgtggctgtttggcattttcttaattaaacatatatttaccaaa
Q05KJ0_BCL2L1-02        catgactgtggctggtgtggttctgctgggct------------------
Q05KJ0_BCL2L1-01        catgactgtggctggtgtggttctgctgggct------------------
                        ** *********** *  *  * * **    *                  

A0A3Q1LRT3_BCL2L1-      caacccagcaattgtactcttgagcatttatctgggagatacgcaacatt
Q05KJ0_BCL2L1-02        --------------cgctcttcag--------tcggaaatga--------
Q05KJ0_BCL2L1-01        --------------cgctcttcag--------tcggaaatga--------
                                        ***** **        * *** **          

A0A3Q1LRT3_BCL2L1-      actgtag
Q05KJ0_BCL2L1-02        -------
Q05KJ0_BCL2L1-01        -------

© 1998-2020Legal notice