Dataset for CDS BCL2L1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2GX13_BCL2L1-      atgtctcagagtaaccgggagctggtggttgactttctctcttacaagct
A0A4W2D608_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
A0A4W2F845_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
                        *********** ** ***** ** **************************

A0A4W2GX13_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A4W2D608_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtggtatgaaagaacaca
A0A4W2F845_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgt------------ca
                        ***********************************             **

A0A4W2GX13_BCL2L1-      gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
A0A4W2D608_BCL2L1-      gaactgagaccccagaagggagagagtcagatatggaaacc---------
A0A4W2F845_BCL2L1-      gatatggaaacccccagtgga-----tcag---tggcaacc---------
                        **  **    ***  *  ***     ****   *** ****         

A0A4W2GX13_BCL2L1-      atcaatggcaacgcatcctggcacctggcggatagccctgctgtgaatgg
A0A4W2D608_BCL2L1-      -------------c--------------ccaatagccccacagtgaatgg
A0A4W2F845_BCL2L1-      -------------catcctggcacctggcagatagccccacagtgaatgg
                                     *              *  *******  * ********

A0A4W2GX13_BCL2L1-      agccactggccacagcagaagctcggatgcccgggaagtgatccccatgg
A0A4W2D608_BCL2L1-      agccactggccacagcagaagcttggatgcccggaaaatgatccccatga
A0A4W2F845_BCL2L1-      agccactggccacagcagaagcttggatgcccggaaaatgatccccatga
                        *********************** ********** ** *********** 

A0A4W2GX13_BCL2L1-      cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
A0A4W2D608_BCL2L1-      caacagtaaagcaagccctgagggaggcaagcaatgagtttaaactttgg
A0A4W2F845_BCL2L1-      caacagtaaagcaagccctgagggaggcaagcaatgagtttaaactgagg
                        ** * ** ********************* ** ******** ****  **

A0A4W2GX13_BCL2L1-      taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
A0A4W2D608_BCL2L1-      taccaacagacattcagcgacctgacgtcccagctccgcatcaccccagg
A0A4W2F845_BCL2L1-      taccaacagacattcagcgacctgatgtcccagctccgcatcaccccagg
                        **** ** * *************** *********** ************

A0A4W2GX13_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
A0A4W2D608_BCL2L1-      gacagcatgtcagagctttgaacaggtaataaatgaactcttccgggaca
A0A4W2F845_BCL2L1-      gacagcatgtcagagctttgaacaggtaataaatgaactcttccgggaca
                        ******** ******************* * ****************** 

A0A4W2GX13_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A4W2D608_BCL2L1-      gggtgaagtggggtcacgttgtggcctttttctccttcagtgggacaata
A0A4W2F845_BCL2L1-      gggtgaagtggggtcacgttgtggcctttttctccttcagtgggacacta
                        ******* ******* * ******************** ***** ** * 

A0A4W2GX13_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A4W2D608_BCL2L1-      tgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcac
A0A4W2F845_BCL2L1-      tgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcac
                        *** ** ***** ************* ** ************* * ** *

A0A4W2GX13_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A4W2D608_BCL2L1-      aacttcaatggccacttacctaaataaccacctcaagccttggatccaag
A0A4W2F845_BCL2L1-      aacttcaacggccacttacctaaataaccacctcaagccttggatccaag
                        *****  * ************ *** *******  ************* *

A0A4W2GX13_BCL2L1-      agaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
A0A4W2D608_BCL2L1-      agaacggcgggtgggacacttttgtggaactctacgaaagcaatacaaca
A0A4W2F845_BCL2L1-      agaacggcgggtgggacacttttgtggaactctacgaaagcaatacaaca
                        ********** *************************  * **** ** **

A0A4W2GX13_BCL2L1-      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
A0A4W2D608_BCL2L1-      aacgagagccagaagggccaggagcgcttcaactcc---------attta
A0A4W2F845_BCL2L1-      aacgagagccagaagggccaagagtgtttcaactcc---------attta
                          ******** ********* *** * ******  *         *    

A0A4W2GX13_BCL2L1-      catgactgtggctggtgtggttct-gctgggctcgct------------c
A0A4W2D608_BCL2L1-      cactactgctgctgtcgcaggcctcgcaaacctcatttcaaacacaaaac
A0A4W2F845_BCL2L1-      cactactgctgctgtcgcaggcctcacaaacctcatttcaaacacaaaac
                        **  ****  ****  *  *  **  *    ***  *            *

A0A4W2GX13_BCL2L1-      ttcagtcggaa---------------------------------------
A0A4W2D608_BCL2L1-      tttattcaaaattagaccaaagatgcccatactatgtgggccactcaggc
A0A4W2F845_BCL2L1-      tttattcaaaattagaccaaagatgcccatactatgtgggccactcaggc
                        ** * **  **                                       

A0A4W2GX13_BCL2L1-      --------atga
A0A4W2D608_BCL2L1-      tcagatagatga
A0A4W2F845_BCL2L1-      tcagatagatga

© 1998-2022Legal notice