Dataset for CDS BCL-2 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2BWN1_BCL2-02      atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaa
A0A4W2BWN1_BCL2-01      atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaa
F6R2C4_BCL2-01          atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaa
O02718_BCL2-01          atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaa
                        **************************************************

A0A4W2BWN1_BCL2-02      gtacatccactataagctgtcgcagcggggctacgagtgggatgccggag
A0A4W2BWN1_BCL2-01      gtacatccactataagctgtcgcagcggggctacgagtgggatgccggag
F6R2C4_BCL2-01          gtacatccactataagctgtcgcagcggggctacgagtgggatgccggag
O02718_BCL2-01          gtacatccactataagctgtcgcagcggggctacgagtgggatgccggag
                        **************************************************

A0A4W2BWN1_BCL2-02      acgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc
A0A4W2BWN1_BCL2-01      acgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc
F6R2C4_BCL2-01          acgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc
O02718_BCL2-01          acgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc
                        **************************************************

A0A4W2BWN1_BCL2-02      tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc
A0A4W2BWN1_BCL2-01      tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc
F6R2C4_BCL2-01          tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc
O02718_BCL2-01          tcccagccgggccgcacacccgccccctccaggacctccccgccgccgcc
                        *********************** **************************

A0A4W2BWN1_BCL2-02      cccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgc
A0A4W2BWN1_BCL2-01      cccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgc
F6R2C4_BCL2-01          cccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgc
O02718_BCL2-01          cccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgc
                        **************************************************

A0A4W2BWN1_BCL2-02      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A4W2BWN1_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
F6R2C4_BCL2-01          acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
O02718_BCL2-01          acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
                        **************************************************

A0A4W2BWN1_BCL2-02      gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
A0A4W2BWN1_BCL2-01      gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
F6R2C4_BCL2-01          gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
O02718_BCL2-01          gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
                        **************************************************

A0A4W2BWN1_BCL2-02      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A4W2BWN1_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
F6R2C4_BCL2-01          gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
O02718_BCL2-01          ggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
                        ** ***********************************************

A0A4W2BWN1_BCL2-02      gggggcgcatcgtggccttctttgagttcggaggggtcatgtg-------
A0A4W2BWN1_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
F6R2C4_BCL2-01          gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
O02718_BCL2-01          gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
                        *******************************************       

A0A4W2BWN1_BCL2-02      -------------------------------------------tgtggat
A0A4W2BWN1_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacagcatcgccctgtggat
F6R2C4_BCL2-01          agcgtcaaccgggagatgtcgcccctggtggacagcatcgccctgtggat
O02718_BCL2-01          agcgtcaaccgggagatgtcgcccctggtggacagcatcgccctgtggat
                                                                   *******

A0A4W2BWN1_BCL2-02      gaccgagtacctgaaccggcacctgcacacctggatccaggacaacggag
A0A4W2BWN1_BCL2-01      gaccgagtacctgaaccggcacctgcacacctggatccaggacaacggag
F6R2C4_BCL2-01          gaccgagtacctgaaccggcacctgcacacctggatccaggacaacggag
O02718_BCL2-01          gaccgagtacctgaaccggcacctgcacacctggatccaggacaacggag
                        **************************************************

A0A4W2BWN1_BCL2-02      gctgggtaggtgctcgtctggatgtg---agtctgagcgggacacctcgg
A0A4W2BWN1_BCL2-01      gctgg---gacgcctttgtggagctgtatggccctagcatgcggcccctg
F6R2C4_BCL2-01          gctgg---gacgcctttgtggagctgtatggccctagcatgcggcccctg
O02718_BCL2-01          gctgg---gacgcctttgtggagctgtatggccctagcatgcggcccctg
                        *****   *  **   * ****  **    * *  ***  *   ** * *

A0A4W2BWN1_BCL2-02      t--------------------------------cccagtgcggtccgagt
A0A4W2BWN1_BCL2-01      tttgatttctcctggctgtctctgaaggcactgctcagtctggccc---t
F6R2C4_BCL2-01          tttgatttctcctggctgtctctgaaggcactgctcagtctggccc---t
O02718_BCL2-01          tttgatttctcctggctgtctctgaaggcactgctcagtctggccc---t
                        *                                * ****  ** **   *

A0A4W2BWN1_BCL2-02      ggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
A0A4W2BWN1_BCL2-01      ggtgggcgcttgcatcaccctgggtgcctatctgggccat-aagtga
F6R2C4_BCL2-01          ggtgggcgcttgcatcaccctgggtgcctatctgggccat-aagtga
O02718_BCL2-01          ggtgggcgcttgcatcaccctgggtgcctatctgggccat-aag---
                        ******   * **    *** ****      * ** *  *  **   

© 1998-2022Legal notice