Dataset for CDS MCL-1 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2CQV1_MCL1-01      atgtgtgaggaggaggaggacgagttatattggcagtccctggagattat
A0A4W2G6Q5_MCL1-01      atgtgtgaggaggaggaggacgagttatattggcagtccctggagattat
                        **************************************************

A0A4W2CQV1_MCL1-01      ctctcggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccc
A0A4W2G6Q5_MCL1-01      ctctcggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccc
                        **************************************************

A0A4W2CQV1_MCL1-01      tgggcaggtctggggccaccagccggaaggcgttggagaccctgcaccga
A0A4W2G6Q5_MCL1-01      tgggcgggtctggggccaccagccggaaggcgttggagaccctgcaccga
                        ***** ********************************************

A0A4W2CQV1_MCL1-01      gtcggggatggggtgcagcacaaccacgagacggctttccaaggcatgct
A0A4W2G6Q5_MCL1-01      gtcggggatggggtgcagcacaaccacgagacggctttccaaggcatgct
                        **************************************************

A0A4W2CQV1_MCL1-01      tcagaaactggacatcaaaaacgaagacgatgttaaatctttgtctcgag
A0A4W2G6Q5_MCL1-01      tcagaaactggacatcaaaaacgaagacgatgttaaatctttgtctcgag
                        **************************************************

A0A4W2CQV1_MCL1-01      tgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtg
A0A4W2G6Q5_MCL1-01      tgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtg
                        **************************************************

A0A4W2CQV1_MCL1-01      actcttatttcttttggtgcctttgtggccaaacactttaagagtataaa
A0A4W2G6Q5_MCL1-01      actcttatttcttttggtgcctttgtggccaaacactttaagagtataaa
                        **************************************************

A0A4W2CQV1_MCL1-01      tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
A0A4W2G6Q5_MCL1-01      tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
                        **************************************************

A0A4W2CQV1_MCL1-01      taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggttt
A0A4W2G6Q5_MCL1-01      taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggttt
                        **************************************************

A0A4W2CQV1_MCL1-01      gtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgct
A0A4W2G6Q5_MCL1-01      gtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgct
                        **************************************************

A0A4W2CQV1_MCL1-01      gctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaa
A0A4W2G6Q5_MCL1-01      gctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaa
                        **************************************************

A0A4W2CQV1_MCL1-01      taagatag
A0A4W2G6Q5_MCL1-01      taagatag
                        ********

© 1998-2023Legal notice