Dataset for CDS BCL-2-like of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

25 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      atgggaacggttctcttttctgggcacccactccagggctggaagagttc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aacaagtgcatggaacgtcagagaccttctggaaatgctgaatttactcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aaggtttcatgaggcccagccggcttctcttcacagcctccagggtcaga
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agccctgcctggcccttgatgccctcctggccctgttcttcctggcctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agcagccctcttctttcctgagttgtggctcttcccaagcctgcgtccca
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gccccgcccctctctctggacgcatctctgggccccatcatcacccggcg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ccgggccctccctcccgccccccctttctcctccctccttccttccctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      cttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      -----------------------------atg------------------
A0A4W2DYC0_BCL2A1-      -----------------------------atg------------------
A0A4W2DYC0_BCL2A1-      -----------------------------atg------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      -----------------------------atg------------------
A0A4W2D608_BCL2L1-      -----------------------------atg------------------
A0A4W2F845_BCL2L1-      -----------------------------atg------------------
A0A4W2D770_MCL1-01      -----------------------------atgttcggcctcaagagaaac
A0A4W2D770_MCL1-02      -----------------------------atgttcggcctcaagagaaac
A0A4W2CQV1_MCL1-01      -----------------------------atg------------------
A0A4W2G6Q5_MCL1-01      -----------------------------atg------------------
A0A4W2BWN1_BCL2-01      -----------------------------atg------------------
A0A4W2BWN1_BCL2-02      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      atcccggcagcggcctgacccccgcccggatg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      -------------------tc-----------------------------
A0A4W2D608_BCL2L1-      -------------------tc-----------------------------
A0A4W2F845_BCL2L1-      -------------------tc-----------------------------
A0A4W2D770_MCL1-01      gcagtaatcggactaaacctctattgtgggggagccggattaggacaggg
A0A4W2D770_MCL1-02      gcagtaatcggactaaacctctattgtgggggagccggattaggacaggg
A0A4W2CQV1_MCL1-01      ------------------------tgtgagg-------------------
A0A4W2G6Q5_MCL1-01      ------------------------tgtgagg-------------------
A0A4W2BWN1_BCL2-01      -------------------gcgcacgcggggggaacaggct---------
A0A4W2BWN1_BCL2-02      -------------------gcgcacgcggggggaacaggct---------
A0A4W2D6A3_BCL2L2-      -------------------gcggcggcggcgg----cggcg---------
A0A4W2GUJ7_BCL2L2-      -------------------gcggcggcggcgg----cggcg---------
A0A4W2D6A3_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2D6A3_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2GUJ7_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2GUJ7_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2GUJ7_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2D6A3_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2GUJ7_BCL2L2-      -------------------gcgaccccagcct----cggcc---------
A0A4W2GUJ7_BCL2L2-      -------------------gcgaccccagcct----cggcc---------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      cagcggcgcctcctctccgggggggcggcttttggctgcggggaaggagg
A0A4W2D770_MCL1-02      cagcggcgcctcctctccgggggggcggctttt-----------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ccacggcgcggcgagaggtagggggaggggaagccggcacggtgattggc
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggag
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ggtcgcgcggccctcgcccattggcgccgagggccccgacgtcaccgcga
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      cccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcct
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      gaagagatggaatccccgatctccgacgccatcatgtcgcccgaagagga
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      gctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccggc
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ctttacctttgttggtcggagaagccagtaacaacagtccaggctcggac
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      ----------------------------------gaaaaggaatttgaag
A0A4W2DYC0_BCL2A1-      ----------------------------------gcggcagcggtggccg
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      ----------------------------------tcagctgactcacttc
A0A4W2FG99_BCL2L10      ----------------------------------tcagctgactcacttc
A0A4W2GX13_BCL2L1-      ----------------------------------tcagagtaaccgggag
A0A4W2D608_BCL2L1-      ----------------------------------tcagagcaatcgggaa
A0A4W2F845_BCL2L1-      ----------------------------------tcagagcaatcgggaa
A0A4W2D770_MCL1-01      ggctcgctgccctcgacgccgcccccagcagaggaggaggaggacgagtt
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      ----------------------------------aggaggaggacgagtt
A0A4W2G6Q5_MCL1-01      ----------------------------------aggaggaggacgagtt
A0A4W2BWN1_BCL2-01      ----------------------------------acgataac--cgagag
A0A4W2BWN1_BCL2-02      ----------------------------------acgataac--cgagag
A0A4W2D6A3_BCL2L2-      ----------------------------------gcagcagcagcggggg
A0A4W2GUJ7_BCL2L2-      ----------------------------------gcagcagcagcggggg
A0A4W2D6A3_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2D6A3_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2D6A3_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ----------------------------------ccagacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ----------------------------------ccagacaca-cgggct

A0A4W2DYC0_BCL2A1-      ------------actg--------acactgagtt-tggctacgttcacgg
A0A4W2DYC0_BCL2A1-      atggcattgttaactg--------gggcaggattgtaaccatattcgc--
A0A4W2DYC0_BCL2A1-      tgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgg
A0A4W2EB77_BCL2L10      -----atggtggaccc--------gtttag--------------------
A0A4W2C0F3_BCL2L10      attccatggtggaccc--------gtttag--------------------
A0A4W2FG99_BCL2L10      attccatggtggaccc--------gtttag--------------------
A0A4W2GX13_BCL2L1-      ctg--gtggttgactt--------tctctc--------------ttacaa
A0A4W2D608_BCL2L1-      cta--gtggttgactt--------tctctc--------------ttacaa
A0A4W2F845_BCL2L1-      cta--gtggttgactt--------tctctc--------------ttacaa
A0A4W2D770_MCL1-01      ata--tcggcagtccc--------tggagataatctctcagtacctccgg
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      ata--ttggcagtccc--------tggagattatctctcggtacctccgg
A0A4W2G6Q5_MCL1-01      ata--ttggcagtccc--------tggagattatctctcggtacctccgg
A0A4W2BWN1_BCL2-01      atc--gtgatgaagta--------catcca--------------ctataa
A0A4W2BWN1_BCL2-02      atc--gtgatgaagta--------catcca--------------ctataa
A0A4W2D6A3_BCL2L2-      ct------gcgggcgg--------tcgggg--------------ctccgg
A0A4W2GUJ7_BCL2L2-      ct------gcgggcgg--------tcgggg--------------ctccgg
A0A4W2D6A3_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2D6A3_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2GUJ7_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2GUJ7_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2GUJ7_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2D6A3_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2GUJ7_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa
A0A4W2GUJ7_BCL2L2-      cta--gtggcagactt--------tgtggg--------------ctataa

A0A4W2DYC0_BCL2A1-      gc-------------tggctgagga-------------------------
A0A4W2DYC0_BCL2A1-      -ctttgaaggtattcttaccaagaaacttctgggcaagtgtattgcctca
A0A4W2DYC0_BCL2A1-      gcgctgagcg--------ctgaggagcggctgcgccag------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      gc------------------------------------------------
A0A4W2D608_BCL2L1-      gc------------------------------------------------
A0A4W2F845_BCL2L1-      gc------------------------------------------------
A0A4W2D770_MCL1-01      ga------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      ga------------------------------------------------
A0A4W2G6Q5_MCL1-01      ga------------------------------------------------
A0A4W2BWN1_BCL2-01      gc------------------------------------------------
A0A4W2BWN1_BCL2-02      gc------------------------------------------------
A0A4W2D6A3_BCL2L2-      gc------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gc------------------------------------------------
A0A4W2D6A3_BCL2L2-      gc------------------------------------------------
A0A4W2D6A3_BCL2L2-      gc------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gc------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gc------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gc------------------------------------------------
A0A4W2D6A3_BCL2L2-      gc------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gc------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gc------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      gacatggacatgtgcaaggacatttctttctttgtggcggagttcatcac
A0A4W2DYC0_BCL2A1-      ------------------------tcccacctcttggc-----------c
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2DYC0_BCL2A1-      --------------------------------------------ctatct
A0A4W2DYC0_BCL2A1-      cgaaaatacaggagagtggataaagcaaaatggaggctgggtgtttaccc
A0A4W2DYC0_BCL2A1-      cagaa----------------------------------ggtgtttaccc
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------tttccc
A0A4W2D608_BCL2L1-      --------------------------------------------tttccc
A0A4W2F845_BCL2L1-      --------------------------------------------tttccc
A0A4W2D770_MCL1-01      --------------------------------------------g-----
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------g-----
A0A4W2G6Q5_MCL1-01      --------------------------------------------g-----
A0A4W2BWN1_BCL2-01      --------------------------------------------t-----
A0A4W2BWN1_BCL2-02      --------------------------------------------t-----
A0A4W2D6A3_BCL2L2-      --------------------------------------------c-----
A0A4W2GUJ7_BCL2L2-      --------------------------------------------c-----
A0A4W2D6A3_BCL2L2-      --------------------------------------------t-----
A0A4W2D6A3_BCL2L2-      --------------------------------------------t-----
A0A4W2GUJ7_BCL2L2-      --------------------------------------------t-----
A0A4W2GUJ7_BCL2L2-      --------------------------------------------t-----
A0A4W2GUJ7_BCL2L2-      --------------------------------------------t-----
A0A4W2D6A3_BCL2L2-      --------------------------------------------t-----
A0A4W2GUJ7_BCL2L2-      --------------------------------------------t-----
A0A4W2GUJ7_BCL2L2-      --------------------------------------------t-----

A0A4W2DYC0_BCL2A1-      gaaatatgtgttg-cagatacagcaacctg--------------------
A0A4W2DYC0_BCL2A1-      ataatgaatatca-aaagtccaaaagagtgtccatctttctgagcatgcc
A0A4W2DYC0_BCL2A1-      ataatgaatatca-aaagtccaaaagagtgtccatctttctgagcatgcc
A0A4W2EB77_BCL2L10      ------ggagc-----gcaccgcccggctg-------------------c
A0A4W2C0F3_BCL2L10      ------ggagc-----gcaccgcccggctg-------------------c
A0A4W2FG99_BCL2L10      ------ggagc-----gcaccgcccggctg-------------------c
A0A4W2GX13_BCL2L1-      agaaaggatacagctggagtcagtttagtg-------------------a
A0A4W2D608_BCL2L1-      agaaaggatacagctggagtcagtttagtg-------------------g
A0A4W2F845_BCL2L1-      agaaaggatacagctggagtcagtttagtg-------------------t
A0A4W2D770_MCL1-01      ------caggcaaccggcgccaaggacgcg-------------------a
A0A4W2D770_MCL1-02      --------ggcaaccggcgccaaggacgcg-------------------a
A0A4W2CQV1_MCL1-01      ------caggcaaccggcgccaaggatgtg-------------------a
A0A4W2G6Q5_MCL1-01      ------caggcaaccggcgccaaggatgtg-------------------a
A0A4W2BWN1_BCL2-01      ------gtcgcag-cggggctacgagtggg-------------------a
A0A4W2BWN1_BCL2-02      ------gtcgcag-cggggctacgagtggg-------------------a
A0A4W2D6A3_BCL2L2-      ------ggggcgg-cggcgccat-cttgtg-------------------c
A0A4W2GUJ7_BCL2L2-      ------ggggcgg-cggcgccat-cttgtg-------------------c
A0A4W2D6A3_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2D6A3_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2GUJ7_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2GUJ7_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2GUJ7_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2D6A3_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2GUJ7_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g
A0A4W2GUJ7_BCL2L2-      ------gaggcag-aaggggtatgtttgtg-------------------g

A0A4W2DYC0_BCL2A1-      ------gatccaagccaagcaaaacatcc--agggtgtt-----acaaga
A0A4W2DYC0_BCL2A1-      agatgaaattgagacagaggagatcatca--aggacattttccgacaagg
A0A4W2DYC0_BCL2A1-      agatgaaattgagacagaggagatcatca--aggacattttccgacaagg
A0A4W2EB77_BCL2L10      tgatggactacctggagttctgcgccc----ggga---------gccggg
A0A4W2C0F3_BCL2L10      tgatggactacctggagttctgcgccc----ggga---------gccggg
A0A4W2FG99_BCL2L10      tgatggactacctggagttctgcgccc----ggga---------gccggg
A0A4W2GX13_BCL2L1-      tgtggaagagaacagaactgaggccccagaagggacagaatcagatatgg
A0A4W2D608_BCL2L1-      tatgaaagaacacagaactgagaccccagaagggagagagtcagatatgg
A0A4W2F845_BCL2L1-      ------------cagatatggaaacccccagtgga-----tcag---tgg
A0A4W2D770_MCL1-01      ag----------------------cccct--gggcgg-------gtctgg
A0A4W2D770_MCL1-02      ag----------------------cccct--gggcgg-------gtctgg
A0A4W2CQV1_MCL1-01      ag----------------------cccct--gggcag-------gtctgg
A0A4W2G6Q5_MCL1-01      ag----------------------cccct--gggcgg-------gtctgg
A0A4W2BWN1_BCL2-01      tgccggagacgcgggcgccgcgccccccg--gggccgctcccgcgccggg
A0A4W2BWN1_BCL2-02      tgccggagacgcgggcgccgcgccccccg--gggccgctcccgcgccggg
A0A4W2D6A3_BCL2L2-      ccgggg------------------ccggt--ggggag-------gccggg
A0A4W2GUJ7_BCL2L2-      ccgggg------------------ccggt--ggggag-------gccggg
A0A4W2D6A3_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2D6A3_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2GUJ7_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2GUJ7_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2GUJ7_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2D6A3_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2GUJ7_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
A0A4W2GUJ7_BCL2L2-      agctgg------------------ccccg--gggagg-------gcccag
                                                *       **                

A0A4W2DYC0_BCL2A1-      tg------------------------------------------------
A0A4W2DYC0_BCL2A1-      ca------------------------------------------------
A0A4W2DYC0_BCL2A1-      ca------------------------------------------------
A0A4W2EB77_BCL2L10      cactc---------------------------------------------
A0A4W2C0F3_BCL2L10      cactc---------------------------------------------
A0A4W2FG99_BCL2L10      cactc---------------------------------------------
A0A4W2GX13_BCL2L1-      aaacccccagtgccatcaatggcaacgcatcctggcacctggcggatagc
A0A4W2D608_BCL2L1-      aaacc----------------------c--------------ccaatagc
A0A4W2F845_BCL2L1-      caacc----------------------catcctggcacctggcagatagc
A0A4W2D770_MCL1-01      ga------------------------------------------------
A0A4W2D770_MCL1-02      ga------------------------------------------------
A0A4W2CQV1_MCL1-01      gg------------------------------------------------
A0A4W2G6Q5_MCL1-01      gg------------------------------------------------
A0A4W2BWN1_BCL2-01      catcc--------------tgtcctcccagccgggccgcacacccgcgcc
A0A4W2BWN1_BCL2-02      catcc--------------tgtcctcccagccgggccgcacacccgcgcc
A0A4W2D6A3_BCL2L2-      ga------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ga------------------------------------------------
A0A4W2D6A3_BCL2L2-      ca------------------------------------------------
A0A4W2D6A3_BCL2L2-      ca------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ca------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ca------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ca------------------------------------------------
A0A4W2D6A3_BCL2L2-      ca------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ca------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ca------------------------------------------------

A0A4W2DYC0_BCL2A1-      ----------------tggcttcctctgtc--------------------
A0A4W2DYC0_BCL2A1-      ----------------aaacctgctttatcc-------------------
A0A4W2DYC0_BCL2A1-      ----------------aaacctgctttatcc-------------------
A0A4W2EB77_BCL2L10      --------cagctcctgcgccgtccacgcctgaggctgccgtgc------
A0A4W2C0F3_BCL2L10      --------cagttcctgcgccgtccacgcctgaggctgccgtgc------
A0A4W2FG99_BCL2L10      --------cagctcctgcgccgtccacgcctgaggctgccgtgc------
A0A4W2GX13_BCL2L1-      cctgctgtgaatggagccactggccacagcagaagctcggatgcccggga
A0A4W2D608_BCL2L1-      cccacagtgaatggagccactggccacagcagaagcttggatgcccggaa
A0A4W2F845_BCL2L1-      cccacagtgaatggagccactggccacagcagaagcttggatgcccggaa
A0A4W2D770_MCL1-01      ----------------------ccacaagccgg-----------------
A0A4W2D770_MCL1-02      ----------------------ccacaagccgg-----------------
A0A4W2CQV1_MCL1-01      ----------------------ccaccagccgg-----------------
A0A4W2G6Q5_MCL1-01      ----------------------ccaccagccgg-----------------
A0A4W2BWN1_BCL2-01      ctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgc
A0A4W2BWN1_BCL2-02      ctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgc
A0A4W2D6A3_BCL2L2-      ------------------gggggccccgggggg-----------------
A0A4W2GUJ7_BCL2L2-      ------------------gggggccccgggggg-----------------
A0A4W2D6A3_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2D6A3_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2GUJ7_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2GUJ7_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2GUJ7_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2D6A3_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2GUJ7_BCL2L2-      ------------------gctgaccc-----gc-----------------
A0A4W2GUJ7_BCL2L2-      ------------------gctgaccc-----gc-----------------

A0A4W2DYC0_BCL2A1-      -----------caggacgaagtggaaaggactctgaagcagtgcttggat
A0A4W2DYC0_BCL2A1-      ---------cgcggtaccagttgcagagcaatc---------acatggat
A0A4W2DYC0_BCL2A1-      ---------cgcggtaccagttgcagagcaatc---------acatggat
A0A4W2EB77_BCL2L10      ---------tgcgccacgtggccgcacgtatccaggaagcaaatcgaaac
A0A4W2C0F3_BCL2L10      ---------tgcgccacgtggccgcacgtatccaggaagcaaatcgaaat
A0A4W2FG99_BCL2L10      ---------tgcgccacgtggccgcacgtatccaggaagcaaatcgaaat
A0A4W2GX13_BCL2L1-      agtgatccccatggca-gcggtgaagcaagccctgagggaggcaggcgat
A0A4W2D608_BCL2L1-      aatgatccccatgaca-acagtaaagcaagccctgagggaggcaagcaat
A0A4W2F845_BCL2L1-      aatgatccccatgaca-acagtaaagcaagccctgagggaggcaagcaat
A0A4W2D770_MCL1-01      -----------------aaggcgttggagaccctgcgccgagtcggggat
A0A4W2D770_MCL1-02      -----------------aaggcgttggagaccctgcgccgagtcggggat
A0A4W2CQV1_MCL1-01      -----------------aaggcgttggagaccctgcaccgagtcggggat
A0A4W2G6Q5_MCL1-01      -----------------aaggcgttggagaccctgcaccgagtcggggat
A0A4W2BWN1_BCL2-01      ccagcccggtgccgcctgtggtgcacctgaccctgcgccaggccggcgat
A0A4W2BWN1_BCL2-02      ccagcccggtgccgcctgtggtgcacctgaccctgcgccaggccggcgat
A0A4W2D6A3_BCL2L2-      ---------------------cgcaggggactacgggaacggcttg----
A0A4W2GUJ7_BCL2L2-      ---------------------cgcaggggactacgggaacggcttg----
A0A4W2D6A3_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2D6A3_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2GUJ7_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2GUJ7_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2GUJ7_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2D6A3_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2GUJ7_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat
A0A4W2GUJ7_BCL2L2-      ---------------------tacaccaagccatgcgggcagctggagat

A0A4W2DYC0_BCL2A1-      aagtttga-------------tgtggtgtccgtaga-----------cac
A0A4W2DYC0_BCL2A1-      atggtgaa-------------gttagcatcgccagaggaaatcgctttgc
A0A4W2DYC0_BCL2A1-      atggtgaa-------------gttagcatcgccagaggaaatcgctttgc
A0A4W2EB77_BCL2L10      gtctt----gcccctataccgcc-------------------------gc
A0A4W2C0F3_BCL2L10      gtctt----gcccctataccgcc-------------------------gc
A0A4W2FG99_BCL2L10      gtctt----gcccctataccgcc-------------------------gc
A0A4W2GX13_BCL2L1-      gagtttga-actgaggtaccgacgggcattcagcgacctgacgtcccagc
A0A4W2D608_BCL2L1-      gagtttaa-actttggtaccaacagacattcagcgacctgacgtcccagc
A0A4W2F845_BCL2L1-      gagtttaa-actgaggtaccaacagacattcagcgacctgatgtcccagc
A0A4W2D770_MCL1-01      ggggtgca-gcgcaaccacgagacggctttccaaggcatgcttcggaaac
A0A4W2D770_MCL1-02      ggggtgca-gcgcaaccacgagacggctttccaaggcatgcttcggaaac
A0A4W2CQV1_MCL1-01      ggggtgca-gcacaaccacgagacggctttccaaggcatgcttcagaaac
A0A4W2G6Q5_MCL1-01      ggggtgca-gcacaaccacgagacggctttccaaggcatgcttcagaaac
A0A4W2BWN1_BCL2-01      gacttctc-tcggcgctaccgccgcgacttcgccgagatgtccagtcagc
A0A4W2BWN1_BCL2-02      gacttctc-tcggcgctaccgccgcgacttcgccgagatgtccagtcagc
A0A4W2D6A3_BCL2L2-      gagtctgaggaactggagcctgaggagctgct----gctggagcccgagc
A0A4W2GUJ7_BCL2L2-      gagtctgaggaactggagcctgaggagctgct----gctggagcccgagc
A0A4W2D6A3_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2D6A3_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2GUJ7_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2GUJ7_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2GUJ7_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2D6A3_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2GUJ7_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc
A0A4W2GUJ7_BCL2L2-      gagttcga-gacccgcttccggcgcaccttctccgatctggcagctcagc

A0A4W2DYC0_BCL2A1-      tg-ccagaac-------aatattcaac----caagtg----------atg
A0A4W2DYC0_BCL2A1-      tgcccagaacttcctggaacattcagc----agcccg----------gtg
A0A4W2DYC0_BCL2A1-      tgcccagaacttcctggaacattcagc----agcccg----------gtg
A0A4W2EB77_BCL2L10      tg-------ccgcaggcaccgcgtcga-------gctggtggccaggatg
A0A4W2C0F3_BCL2L10      tg-------ccgcaggcaccgcgtcga-------gctggtggccaggatg
A0A4W2FG99_BCL2L10      tg-------ccgcaggcaccgcgtcga-------gctggtggccaggatg
A0A4W2GX13_BCL2L1-      tccacatcaccccagggacagcatatc----agagct-ttgaacag-gta
A0A4W2D608_BCL2L1-      tccgcatcaccccagggacagcatgtc----agagct-ttgaacag-gta
A0A4W2F845_BCL2L1-      tccgcatcaccccagggacagcatgtc----agagct-ttgaacag-gta
A0A4W2D770_MCL1-01      tg-----gacatcaaaaatgaagacgatgtcaaatct-ttgtctcgagtg
A0A4W2D770_MCL1-02      tg-----gacatcaaaaatgaagacgatgtcaaatct-ttgtctcgagtg
A0A4W2CQV1_MCL1-01      tg-----gacatcaaaaacgaagacgatgttaaatct-ttgtctcgagtg
A0A4W2G6Q5_MCL1-01      tg-----gacatcaaaaacgaagacgatgttaaatct-ttgtctcgagtg
A0A4W2BWN1_BCL2-01      tgcacctgacgcccttcaccgcgaggg----gacgct-tcgccacg-gtg
A0A4W2BWN1_BCL2-02      tgcacctgacgcccttcaccgcgaggg----gacgct-tcgccacg-gtg
A0A4W2D6A3_BCL2L2-      cg-----gagcccgagcccga---aga----ggagc---cgccccg-gcc
A0A4W2GUJ7_BCL2L2-      cg-----gagcccgagcccga---aga----ggagc---cgccccg-gcc
A0A4W2D6A3_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2D6A3_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2GUJ7_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2GUJ7_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2GUJ7_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2D6A3_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2GUJ7_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc
A0A4W2GUJ7_BCL2L2-      tgcatgtgaccccgggctcggcccagc----aacgct-tcacccag-gtc

A0A4W2DYC0_BCL2A1-      gaaaaggaatt-t--gaaga------tggcattgttaactggggcaggat
A0A4W2DYC0_BCL2A1-      aggatgaagttct--ggagg------aggccttgtcaacagggg--gact
A0A4W2DYC0_BCL2A1-      aggatgaagttct--ggagg------aggccttgtcaacagggg--gact
A0A4W2EB77_BCL2L10      gcgcagaggctactcgacgaagaccctggcc---ccagctggggccgcgt
A0A4W2C0F3_BCL2L10      gcgcagaggctactcgacgaagaccctggcc---ccagctggggccgcgt
A0A4W2FG99_BCL2L10      gcgcagaggctactcgacgaagaccctggcc---ccagctggggccgcgt
A0A4W2GX13_BCL2L1-      gtgaatgaactcttccggga------cgggg---tgaactggggtcgcat
A0A4W2D608_BCL2L1-      ataaatgaactcttccggga------caggg---tgaagtggggtcacgt
A0A4W2F845_BCL2L1-      ataaatgaactcttccggga------caggg---tgaagtggggtcacgt
A0A4W2D770_MCL1-01      atggttcatgttttcagtga------cggagtaacaaactggggcaggat
A0A4W2D770_MCL1-02      atggttcatgttttcagtga------cggagtaacaaactggggcaggat
A0A4W2CQV1_MCL1-01      atggttcatgttttcagtga------cagagtaacaaactggggcaggat
A0A4W2G6Q5_MCL1-01      atggttcatgttttcagtga------cagagtaacaaactggggcaggat
A0A4W2BWN1_BCL2-01      gtggaggagctcttcaggga------cgggg---tgaactgggggcgcat
A0A4W2BWN1_BCL2-02      gtggaggagctcttcaggga------cgggg---tgaactgggggcgcat
A0A4W2D6A3_BCL2L2-      cc------gcgcccccccgg------gagct---ccgg--------gccc
A0A4W2GUJ7_BCL2L2-      cc------gcgcccccccgg------gagct---ccgg--------gccc
A0A4W2D6A3_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2D6A3_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2GUJ7_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2GUJ7_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2GUJ7_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2D6A3_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2GUJ7_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
A0A4W2GUJ7_BCL2L2-      tctgatgaactcttccaagg------gggcc---ccaactggggccgcct
                                          *         *                     

A0A4W2DYC0_BCL2A1-      tgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggca
A0A4W2DYC0_BCL2A1-      tgacctcatcttcgtgcc---gggtctcgggttcgacaaa---cagagca
A0A4W2DYC0_BCL2A1-      tgacctcatcttcgtgcc---gggtctcgggttcgacaaa---cagagca
A0A4W2EB77_BCL2L10      ggcctcactcgtaacctt-------------------------cgcgggg
A0A4W2C0F3_BCL2L10      ggcctcactcgtgacctt-------------------------cgcgggg
A0A4W2FG99_BCL2L10      ggcctcactcgtgacctt-------------------------cgcgggg
A0A4W2GX13_BCL2L1-      tgtggcctttttctcctt-------------------------cggtggg
A0A4W2D608_BCL2L1-      tgtggcctttttctcctt-------------------------cagtggg
A0A4W2F845_BCL2L1-      tgtggcctttttctcctt-------------------------cagtggg
A0A4W2D770_MCL1-01      tgtgactcttatttcttt-------------------------tggtgcc
A0A4W2D770_MCL1-02      tgtgactcttatttcttt-------------------------tggtgcc
A0A4W2CQV1_MCL1-01      tgtgactcttatttcttt-------------------------tggtgcc
A0A4W2G6Q5_MCL1-01      tgtgactcttatttcttt-------------------------tggtgcc
A0A4W2BWN1_BCL2-01      cgtggccttctttgagtt-------------------------cggaggg
A0A4W2BWN1_BCL2-02      cgtggccttctttgagtt-------------------------cggaggg
A0A4W2D6A3_BCL2L2-      tg-ggcc-----tggctc-------------------------gggagcc
A0A4W2GUJ7_BCL2L2-      tg-ggcc-----tggctc-------------------------gggagcc
A0A4W2D6A3_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2D6A3_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2GUJ7_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2GUJ7_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2GUJ7_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2D6A3_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2GUJ7_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
A0A4W2GUJ7_BCL2L2-      tgtggccttctttgtctt-------------------------tggagcc
                         *                                             *  

A0A4W2DYC0_BCL2A1-      agtgta------ttgcctcagacatggacatgtgc---------------
A0A4W2DYC0_BCL2A1-      accgtt------tgggacggggcaagggc---tac---------------
A0A4W2DYC0_BCL2A1-      accgtt------tgggacggggcaagggc---tac---------------
A0A4W2EB77_BCL2L10      tcgctg---------ctggagaggccaccgcagacgacccgacggcagga
A0A4W2C0F3_BCL2L10      tcgctg---------ctggagaggccgccgcagactacccgacggc---a
A0A4W2FG99_BCL2L10      tcgctg---------ctggagaggccgccgcagactacccgacggc---a
A0A4W2GX13_BCL2L1-      gcactg------tgcgtggaaag-----cgtagac---------------
A0A4W2D608_BCL2L1-      acaata------tgcatgaaaag-----catagac---------------
A0A4W2F845_BCL2L1-      acacta------tgcatgaaaag-----catagac---------------
A0A4W2D770_MCL1-01      tttgtggccaaacacttgaagag-----tataaat---------------
A0A4W2D770_MCL1-02      tttgtggccaaacacttgaagag-----tataaat---------------
A0A4W2CQV1_MCL1-01      tttgtggccaaacactttaagag-----tataaat---------------
A0A4W2G6Q5_MCL1-01      tttgtggccaaacactttaagag-----tataaat---------------
A0A4W2BWN1_BCL2-01      gtcatg------tgtgtggagag-----cgtcaac---------------
A0A4W2BWN1_BCL2-02      gtcatg------tg------------------------------------
A0A4W2D6A3_BCL2L2-      cc--------------------------cggcaat---------------
A0A4W2GUJ7_BCL2L2-      cc--------------------------cggcaat---------------
A0A4W2D6A3_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2D6A3_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2GUJ7_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2GUJ7_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2GUJ7_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2D6A3_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2GUJ7_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------
A0A4W2GUJ7_BCL2L2-      gcgttg------tgtgctgagag-----tgtcaac---------------

A0A4W2DYC0_BCL2A1-      aaggacatttctttctttgtggcggagttcatcaccgaaaatacaggaga
A0A4W2DYC0_BCL2A1-      tatgacgcctacct---------gaag--cgttgtctgcagtcccaggac
A0A4W2DYC0_BCL2A1-      tatgacgcctacct---------gaag--cgttgtctgcagtcccaggac
A0A4W2EB77_BCL2L10      gaagagagacg-ac---------gacggcgttagcagggactgtcggctc
A0A4W2C0F3_BCL2L10      gaagagagacg-ac---------gacggcgttagcagggactgtcggctc
A0A4W2FG99_BCL2L10      gaagagagacg-ac---------gacggcgttagcagggactgtcggctc
A0A4W2GX13_BCL2L1-      aaggag------at---------gcaggtattggtgagtcggatcgcaac
A0A4W2D608_BCL2L1-      aaggag------at---------acacgtattggtgagtcaggtcacaac
A0A4W2F845_BCL2L1-      aaggag------at---------acacgtattggtgagtcaggtcacaac
A0A4W2D770_MCL1-01      caagaaagctgcat---------cgaaccactagcagaaagcat-----c
A0A4W2D770_MCL1-02      caagaaagctgcat---------cgaaccactagcagaaagcat-----c
A0A4W2CQV1_MCL1-01      caagaaagctgcat---------cgaaccactagcagaaagcat-----c
A0A4W2G6Q5_MCL1-01      caagaaagctgcat---------cgaaccactagcagaaagcat-----c
A0A4W2BWN1_BCL2-01      cgggag------at---------gtcgcccctggtggacagcatcgccct
A0A4W2BWN1_BCL2-02      -------------------------------------------------t
A0A4W2D6A3_BCL2L2-      caggag------ga---------gga----------ggaggagt-cggga
A0A4W2GUJ7_BCL2L2-      caggag------ga---------gga----------ggaggagt-cggga
A0A4W2D6A3_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2D6A3_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2GUJ7_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2GUJ7_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2GUJ7_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2D6A3_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2GUJ7_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga
A0A4W2GUJ7_BCL2L2-      aaggag------at---------ggagccacttgtgggacaagtgcagga

A0A4W2DYC0_BCL2A1-      gtggataaagcaaaatggaggctgggaaaatgggtttgtaaag---aagt
A0A4W2DYC0_BCL2A1-      gtga--aaccctacaccctggcc-------ttggctttcaaagagcagat
A0A4W2DYC0_BCL2A1-      gtga--aaccctacaccctggcc-------ttggctttcaaagagcagat
A0A4W2EB77_BCL2L10      ctggtggcccttctgt-gtgctc--------agttctgcgaaaggcacc-
A0A4W2C0F3_BCL2L10      ctggtggcccttctgt-gtgctc--------agttctgcgaaaggcacc-
A0A4W2FG99_BCL2L10      ctggtggcccttctgt-gtgctc--------agttctgcgaaaggcacc-
A0A4W2GX13_BCL2L1-      ttggatggccacttac-ctg-------------------aatgaccacct
A0A4W2D608_BCL2L1-      ttcaatggccacttac-cta-------------------aataaccacct
A0A4W2F845_BCL2L1-      ttcaacggccacttac-cta-------------------aataaccacct
A0A4W2D770_MCL1-01      acagatgttctcgtaaggtc-------------------aaaacgagact
A0A4W2D770_MCL1-02      acagatgttctcgtaaggtc-------------------aaaacgagact
A0A4W2CQV1_MCL1-01      acagatgttctcgtaaggtc-------------------aaaacgagact
A0A4W2G6Q5_MCL1-01      acagatgttctcgtaaggtc-------------------aaaacgagact
A0A4W2BWN1_BCL2-01      gtggatgaccgagtac-ctg-------------------aaccggcacct
A0A4W2BWN1_BCL2-02      gtggatgaccgagtac-ctg-------------------aaccggcacct
A0A4W2D6A3_BCL2L2-      ctggtcgagggtgacc-cgg-------------------gggacggcgc-
A0A4W2GUJ7_BCL2L2-      ctggtcgagggtgacc-cgg-------------------gggacggcgc-
A0A4W2D6A3_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2D6A3_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2GUJ7_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2GUJ7_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2GUJ7_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2D6A3_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2GUJ7_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct
A0A4W2GUJ7_BCL2L2-      gtggatggtggcctac-ctg-------------------gagacgaggct

A0A4W2DYC0_BCL2A1-      ttgaaaccaaatctggctggctgacttttc--------------------
A0A4W2DYC0_BCL2A1-      ctgcctccaggtcccggtgaatgagaatga--------------------
A0A4W2DYC0_BCL2A1-      ctgcctccaggtcccggtgaatgagaatga--------------------
A0A4W2EB77_BCL2L10      --gcgcctggctgatgactaacggcggctg--------------------
A0A4W2C0F3_BCL2L10      --gcgcctggctgatggctaacggcggctg--------------------
A0A4W2FG99_BCL2L10      --gcgcctggctgatggctaacggcggctg--------------------
A0A4W2GX13_BCL2L1-      agagccttggatccaggagaacggcggctg--------------------
A0A4W2D608_BCL2L1-      caagccttggatccaagagaacggcgggtg--------------------
A0A4W2F845_BCL2L1-      caagccttggatccaagagaacggcgggtg--------------------
A0A4W2D770_MCL1-01      ggatagtcaaacaaa--------gaggctg--------------------
A0A4W2D770_MCL1-02      ggatagtcaaacaaa--------gaggctg--------------------
A0A4W2CQV1_MCL1-01      ggatagtcaaagaaa--------gaggctg--------------------
A0A4W2G6Q5_MCL1-01      ggatagtcaaagaaa--------gaggctg--------------------
A0A4W2BWN1_BCL2-01      gcacacctggatccaggacaacggaggctg--------------------
A0A4W2BWN1_BCL2-02      gcacacctggatccaggacaacggaggctg--------------------
A0A4W2D6A3_BCL2L2-      ------------------cattgaggaccc--------------------
A0A4W2GUJ7_BCL2L2-      ------------------cattgaggaccc--------------------
A0A4W2D6A3_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2D6A3_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2GUJ7_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2GUJ7_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2GUJ7_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2D6A3_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2GUJ7_BCL2L2-      ggctgactggatccacagcagtgggggctg--------------------
A0A4W2GUJ7_BCL2L2-      ggctgactggatccacagcagtgggggctggttctcccagaccagtgaag

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ctgagatggttcatgaagtatttttcggtgaaattttaagcaactgtgac

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------ggatggattttgtctctt
A0A4W2C0F3_BCL2L10      --------------------------------ggatggattttgtctctt
A0A4W2FG99_BCL2L10      --------------------------------ggatggattttgtctctt
A0A4W2GX13_BCL2L1-      --------------------------------ggacacttt---------
A0A4W2D608_BCL2L1-      --------------------------------ggacacttt---------
A0A4W2F845_BCL2L1-      --------------------------------ggacacttt---------
A0A4W2D770_MCL1-01      --------------------------------ggatgggtt---------
A0A4W2D770_MCL1-02      --------------------------------ggatgggtt---------
A0A4W2CQV1_MCL1-01      --------------------------------ggatgggtt---------
A0A4W2G6Q5_MCL1-01      --------------------------------ggatgggtt---------
A0A4W2BWN1_BCL2-01      --------------------------------------g---gacgcctt
A0A4W2BWN1_BCL2-02      --------------------------------------ggtaggtgctcg
A0A4W2D6A3_BCL2L2-      --------------------------ggagctggaagcgatcaaagctcg
A0A4W2GUJ7_BCL2L2-      --------------------------ggagctggaagcgatcaaagctcg
A0A4W2D6A3_BCL2L2-      --------------------------------ggcggagttcacagctct
A0A4W2D6A3_BCL2L2-      --------------------------------ggcggagttcacagctct
A0A4W2GUJ7_BCL2L2-      --------------------------------ggcggagttcacagctct
A0A4W2GUJ7_BCL2L2-      --------------------------------ggcggagttcacagctct
A0A4W2GUJ7_BCL2L2-      --------------------------ggagctggaagcgatcaaagctcg
A0A4W2D6A3_BCL2L2-      --------------------------ggagctggaagcgatcaaagctcg
A0A4W2GUJ7_BCL2L2-      --------------------------ggagctggaagcgatcaaagctcg
A0A4W2GUJ7_BCL2L2-      tctgctccaagttctcctgttcctgaggagctggaagcgatcaaagctcg

A0A4W2DYC0_BCL2A1-      ---tg-gaagttaca--------------------------ggaaagatc
A0A4W2DYC0_BCL2A1-      ---tgtgaaggtaga--------------------------cga------
A0A4W2DYC0_BCL2A1-      ---tgtgaaggtaga--------------------------cga------
A0A4W2EB77_BCL2L10      cttc--ccactcatt------------------------cca-ccatctt
A0A4W2C0F3_BCL2L10      tttcagccagtcatt------------------------ccagccatctt
A0A4W2FG99_BCL2L10      tttcagccagtcatt------------------------ccagccatctt
A0A4W2GX13_BCL2L1-      ---tgtggaactctacgggaacaatgcagcagccgagagccggaagggcc
A0A4W2D608_BCL2L1-      ---tgtggaactctacgaaagcaatacaacaaacgagagccagaagggcc
A0A4W2F845_BCL2L1-      ---tgtggaactctacgaaagcaatacaacaaacgagagccagaagggcc
A0A4W2D770_MCL1-01      ---tgtggagttcttccatgtag------------aggacctagaaggcg
A0A4W2D770_MCL1-02      ---tgtggagttcttccatgtag------------aggacctagaaggcg
A0A4W2CQV1_MCL1-01      ---tgtggagttcttccatgtag------------aggacctagaaggcg
A0A4W2G6Q5_MCL1-01      ---tgtggagttcttccatgtag------------aggacctagaaggcg
A0A4W2BWN1_BCL2-01      ---tgtggagctgta-----------------------------tggccc
A0A4W2BWN1_BCL2-02      ---tctggatgtg--------------------------------agtct
A0A4W2D6A3_BCL2L2-      agttagggagatgga-----gga------------agaagctgagaagct
A0A4W2GUJ7_BCL2L2-      agttagggagatgga-----gga------------agaagctgagaagct
A0A4W2D6A3_BCL2L2-      a--tacggggacggggccctgga------------ggaggcgcggcgtct
A0A4W2D6A3_BCL2L2-      a--tacggggacggggccctgga------------ggaggcgcggcgtct
A0A4W2GUJ7_BCL2L2-      a--tacggggacggggccctgga------------ggaggcgcggcgtct
A0A4W2GUJ7_BCL2L2-      a--tacggggacggggccctgga------------ggaggcgcggcgtct
A0A4W2GUJ7_BCL2L2-      agttagggagatgga-----gga------------agaagctgagaagct
A0A4W2D6A3_BCL2L2-      agttagggagatgga-----gga------------agaagctgagaagct
A0A4W2GUJ7_BCL2L2-      agttagggagatgga-----gga------------agaagctgagaagct
A0A4W2GUJ7_BCL2L2-      agttagggagatgga-----gga------------agaagctgagaagct

A0A4W2DYC0_BCL2A1-      tgtgaaa-------------------------------------------
A0A4W2DYC0_BCL2A1-      ---ggtg-------------------------------------------
A0A4W2DYC0_BCL2A1-      ---ggtg-------------------------------------------
A0A4W2EB77_BCL2L10      gggaaag--------------------------------------acagc
A0A4W2C0F3_BCL2L10      gggaaag--------------------------------------acagc
A0A4W2FG99_BCL2L10      gggaaag--------------------------------------acagc
A0A4W2GX13_BCL2L1-      aggagcgct---------------------------------tcaaccgc
A0A4W2D608_BCL2L1-      aggagcgct---------------------------------tcaactcc
A0A4W2F845_BCL2L1-      aagagtgtt---------------------------------tcaactcc
A0A4W2D770_MCL1-01      gcatcag--------------------------------aaatgtgctgc
A0A4W2D770_MCL1-02      gcatcag--------------------------------aaatgtgctgc
A0A4W2CQV1_MCL1-01      gcatcag--------------------------------aaatgtgctgc
A0A4W2G6Q5_MCL1-01      gcatcag--------------------------------aaatgtgctgc
A0A4W2BWN1_BCL2-01      tagcatg------------------------------------cggcccc
A0A4W2BWN1_BCL2-02      gagcggg------------------------------------acacctc
A0A4W2D6A3_BCL2L2-      aaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctc
A0A4W2GUJ7_BCL2L2-      aaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctc
A0A4W2D6A3_BCL2L2-      gcgggag---------------gggaa----------------------c
A0A4W2D6A3_BCL2L2-      gcgggag---------------gggaa----------------------c
A0A4W2GUJ7_BCL2L2-      gcgggag---------------gggaa----------------------c
A0A4W2GUJ7_BCL2L2-      gcgggag---------------gggaa----------------------c
A0A4W2GUJ7_BCL2L2-      aaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctc
A0A4W2D6A3_BCL2L2-      aaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctc
A0A4W2GUJ7_BCL2L2-      aaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctc
A0A4W2GUJ7_BCL2L2-      aaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctc

A0A4W2DYC0_BCL2A1-      -----------------------------------cattatgtcgcctga
A0A4W2DYC0_BCL2A1-      -----------------------------------ctttacg--------
A0A4W2DYC0_BCL2A1-      -----------------------------------ctttacg--------
A0A4W2EB77_BCL2L10      tggtctggtttttcct-------------------ctcatactggacagc
A0A4W2C0F3_BCL2L10      tggtctggtttttcct-------------------cgcatactggacagc
A0A4W2FG99_BCL2L10      tggtctggtttttcct-------------------cgcatactggacagc
A0A4W2GX13_BCL2L1-      tggttcctgacgggc--------------------atgactgtggctgg-
A0A4W2D608_BCL2L1-      ---------atttac--------------------actactgctgctgt-
A0A4W2F845_BCL2L1-      ---------atttac--------------------actactgctgctgt-
A0A4W2D770_MCL1-01      tggctttt---------------------------gcaggtgttgccgg-
A0A4W2D770_MCL1-02      tggctttt---------------------------gcaggtgttgccgg-
A0A4W2CQV1_MCL1-01      tggctttt---------------------------gcaggtgttgccgg-
A0A4W2G6Q5_MCL1-01      tggctttt---------------------------gcaggtgttgccgg-
A0A4W2BWN1_BCL2-01      tgtttgatttctcctggctgtctctgaaggcactgctcagtctggccc--
A0A4W2BWN1_BCL2-02      ggt--------------------------------cccagtgcggtccg-
A0A4W2D6A3_BCL2L2-      cgggcaatgctggcccagtgatcatg---------tccattgaggagaa-
A0A4W2GUJ7_BCL2L2-      cgggcaatgctggcccagtgatcatg---------tccattgaggagaa-
A0A4W2D6A3_BCL2L2-      tgggc------------------------------ttcagtgaggacagt
A0A4W2D6A3_BCL2L2-      tgggc------------------------------ttcagtgaggacagt
A0A4W2GUJ7_BCL2L2-      tgggc------------------------------ttcagtgaggacagt
A0A4W2GUJ7_BCL2L2-      tgggc------------------------------ttcagtgaggacagt
A0A4W2GUJ7_BCL2L2-      cgggcaatgctggcccagtgatcatg---------tccattgaggagaa-
A0A4W2D6A3_BCL2L2-      cgggcaatgctggcccagtgatcatg---------tccattgaggagaa-
A0A4W2GUJ7_BCL2L2-      cgggcaatgctggcccagtgatcatg---------tccattgaggagaa-
A0A4W2GUJ7_BCL2L2-      cgggcaatgctggcccagtgatcatg---------tccattgaggagaa-

A0A4W2DYC0_BCL2A1-      agcaatactattga------------------------------------
A0A4W2DYC0_BCL2A1-      ---aagactcctga------------------------------------
A0A4W2DYC0_BCL2A1-      ---aagactcctga------------------------------------
A0A4W2EB77_BCL2L10      aataatcataatct------------------------------acttct
A0A4W2C0F3_BCL2L10      aataatcataatct------------------------------acttct
A0A4W2FG99_BCL2L10      aataatcataatct------------------------------acttct
A0A4W2GX13_BCL2L1-      ---tgtggttct-g---------ctgggctcgct------------cttc
A0A4W2D608_BCL2L1-      ---cgcaggcctcg---------caaacctcatttcaaacacaaaacttt
A0A4W2F845_BCL2L1-      ---cgcaggcctca---------caaacctcatttcaaacacaaaacttt
A0A4W2D770_MCL1-01      ---agtaggagctg------------------------gtttggcatatc
A0A4W2D770_MCL1-02      ---agtaggagctg------------------------gtttggcatatc
A0A4W2CQV1_MCL1-01      ---agtaggagctg------------------------gtttggcatatc
A0A4W2G6Q5_MCL1-01      ---agtaggagctg------------------------gtttggcatatc
A0A4W2BWN1_BCL2-01      --tggtgggcgctt------gcatcaccctgggtgcctatctgggccat-
A0A4W2BWN1_BCL2-02      agtggtggggtgtg------gctgggcccagggtcaagggcaggccggtg
A0A4W2D6A3_BCL2L2-      ---gatggaggctgatgcccgttccatctatgttggcaatgtggactatg
A0A4W2GUJ7_BCL2L2-      ---gatggaggctgatgcccgttccatctatgttggcaatgtggactatg
A0A4W2D6A3_BCL2L2-      gctgacgggggctg-------------------tggcactgggggccctg
A0A4W2D6A3_BCL2L2-      gctgacgggggctg-------------------tggcactgggggccctg
A0A4W2GUJ7_BCL2L2-      gctgacgggggctg-------------------tggcactgggggccctg
A0A4W2GUJ7_BCL2L2-      gctgacgggggctg-------------------tggcactgggggccctg
A0A4W2GUJ7_BCL2L2-      ---gatggaggctgatgcccgttccatctatgttggcaatgtggactatg
A0A4W2D6A3_BCL2L2-      ---gatggaggctgatgcccgttccatctatgttggcaatgtggactatg
A0A4W2GUJ7_BCL2L2-      ---gatggaggctgatgcccgttccatctatgttggcaatgtggactatg
A0A4W2GUJ7_BCL2L2-      ---gatggaggctgatgcccgttccatctatgttggcaatgtggactatg

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      ggataaaattatcgtga---------------------------------
A0A4W2C0F3_BCL2L10      ggataaaattattgtga---------------------------------
A0A4W2FG99_BCL2L10      ggataaaattattgtga---------------------------------
A0A4W2GX13_BCL2L1-      agtcggaa------------------------------------------
A0A4W2D608_BCL2L1-      attcaaaattagaccaaagatgcccatactatgtgggccactcaggctca
A0A4W2F845_BCL2L1-      attcaaaattagaccaaagatgcccatactatgtgggccactcaggctca
A0A4W2D770_MCL1-01      taataa--------------------------------------------
A0A4W2D770_MCL1-02      taataa--------------------------------------------
A0A4W2CQV1_MCL1-01      taataa--------------------------------------------
A0A4W2G6Q5_MCL1-01      taataa--------------------------------------------
A0A4W2BWN1_BCL2-01      aagtga--------------------------------------------
A0A4W2BWN1_BCL2-02      gagtaa--------------------------------------------
A0A4W2D6A3_BCL2L2-      gtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtc
A0A4W2GUJ7_BCL2L2-      gtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtc
A0A4W2D6A3_BCL2L2-      gt------------------------------------------------
A0A4W2D6A3_BCL2L2-      gt------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gt------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gt------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtc
A0A4W2D6A3_BCL2L2-      gtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtc
A0A4W2GUJ7_BCL2L2-      gtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtc
A0A4W2GUJ7_BCL2L2-      gtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtc

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      -----atga-----------------------------------------
A0A4W2D608_BCL2L1-      gatagatga-----------------------------------------
A0A4W2F845_BCL2L1-      gatagatga-----------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      aaccgcgtaactatactctgtgacaaatttagtggccatccgaaagggtt
A0A4W2GUJ7_BCL2L2-      aaccgcgtaactatactctgtgacaaatttagtggccatccgaaagggtt
A0A4W2D6A3_BCL2L2-      ------------------------aactgtaggggcctt-----------
A0A4W2D6A3_BCL2L2-      ------------------------aactgtaggggcctt-----------
A0A4W2GUJ7_BCL2L2-      ------------------------aactgtaggggcctt-----------
A0A4W2GUJ7_BCL2L2-      ------------------------aactgtaggggcctt-----------
A0A4W2GUJ7_BCL2L2-      aaccgcgtaactatactctgtgacaaatttagtggccatccgaaagggtt
A0A4W2D6A3_BCL2L2-      aaccgcgtaactatactctgtgacaaatttagtggccatccgaaagggtt
A0A4W2GUJ7_BCL2L2-      aaccgcgtaactatactctgtgacaaatttagtggccatccgaaagggtt
A0A4W2GUJ7_BCL2L2-      aaccgcgtaactatactctgtgacaaatttagtggccatccgaaagggtt

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      tgcgtatatagagttctcagacaaagagtcagtgaggacttccctggcct
A0A4W2GUJ7_BCL2L2-      tgcgtatatagagttctcagacaaagagtcagtgaggacttccctggcct
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      tgcgtatatagagttctcagacaaagagtcagtgaggacttccctggcct
A0A4W2D6A3_BCL2L2-      tgcgtatatagagttctcagacaaagagtcagtgaggacttccctggcct
A0A4W2GUJ7_BCL2L2-      tgcgtatatagagttctcagacaaagagtcagtgaggacttccctggcct
A0A4W2GUJ7_BCL2L2-      tgcgtatatagagttctcagacaaagagtcagtgaggacttccctggcct

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      tagatgaatccttatttagaggaagacagatcaaggtgatccctaaacga
A0A4W2GUJ7_BCL2L2-      tagatgaatccttatttagaggaagacagatcaaggtgatccctaaacga
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      tagatgaatccttatttagaggaagacagatcaaggtgatccctaaacga
A0A4W2D6A3_BCL2L2-      tagatgaatccttatttagaggaagacagatcaaggtgatccctaaacga
A0A4W2GUJ7_BCL2L2-      tagatgaatccttatttagaggaagacagatcaaggtgatccctaaacga
A0A4W2GUJ7_BCL2L2-      tagatgaatccttatttagaggaagacagatcaaggtgatccctaaacga

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      accaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccg
A0A4W2GUJ7_BCL2L2-      accaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccg
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      accaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccg
A0A4W2D6A3_BCL2L2-      accaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccg
A0A4W2GUJ7_BCL2L2-      accaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccg
A0A4W2GUJ7_BCL2L2-      accaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccg

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      ataccgtgcccgaaccaccaactacaacagttcccgctctcgattctaca
A0A4W2GUJ7_BCL2L2-      ataccgtgcccgaaccaccaactacaacagttcccgctctcgattctaca
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ataccgtgcccgaaccaccaactacaacagttcccgctctcgattctaca
A0A4W2D6A3_BCL2L2-      ataccgtgcccgaaccaccaactacaacagttcccgctctcgattctaca
A0A4W2GUJ7_BCL2L2-      ataccgtgcccgaaccaccaactacaacagttcccgctctcgattctaca
A0A4W2GUJ7_BCL2L2-      ataccgtgcccgaaccaccaactacaacagttcccgctctcgattctaca

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------gatag-
A0A4W2D770_MCL1-02      --------------------------------------------gatag-
A0A4W2CQV1_MCL1-01      --------------------------------------------gatag-
A0A4W2G6Q5_MCL1-01      --------------------------------------------gatag-
A0A4W2BWN1_BCL2-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      gtggttttaacagcaggccccggggtcgcgtctaca--ggtcaggatag-
A0A4W2GUJ7_BCL2L2-      gtggttttaacagcaggccccggggtcgcgtctaca--ggtcaggatag-
A0A4W2D6A3_BCL2L2-      ----ttttgctagcaag---------------------------------
A0A4W2D6A3_BCL2L2-      ----ttttgctagcaag---------------------------------
A0A4W2GUJ7_BCL2L2-      ----ttttgctagcaag---------------------------------
A0A4W2GUJ7_BCL2L2-      ----ttttgctagcaag---------------------------------
A0A4W2GUJ7_BCL2L2-      gtggttttaacagcaggccccggggtcgcgtctaca--ggtcaggatag-
A0A4W2D6A3_BCL2L2-      gtggttttaacagcaggccccggggtcgcgtctacaggggccgggctaga
A0A4W2GUJ7_BCL2L2-      gtggttttaacagcaggccccggggtcgcgtctacaggggccgggctaga
A0A4W2GUJ7_BCL2L2-      gtggttttaacagcaggccccggggtcgcgtctacaggggccgggctaga

A0A4W2DYC0_BCL2A1-      ---------------------------
A0A4W2DYC0_BCL2A1-      ---------------------------
A0A4W2DYC0_BCL2A1-      ---------------------------
A0A4W2EB77_BCL2L10      ---------------------------
A0A4W2C0F3_BCL2L10      ---------------------------
A0A4W2FG99_BCL2L10      ---------------------------
A0A4W2GX13_BCL2L1-      ---------------------------
A0A4W2D608_BCL2L1-      ---------------------------
A0A4W2F845_BCL2L1-      ---------------------------
A0A4W2D770_MCL1-01      ---------------------------
A0A4W2D770_MCL1-02      ---------------------------
A0A4W2CQV1_MCL1-01      ---------------------------
A0A4W2G6Q5_MCL1-01      ---------------------------
A0A4W2BWN1_BCL2-01      ---------------------------
A0A4W2BWN1_BCL2-02      ---------------------------
A0A4W2D6A3_BCL2L2-      ---------------------------
A0A4W2GUJ7_BCL2L2-      ---------------------------
A0A4W2D6A3_BCL2L2-      ------------------------tga
A0A4W2D6A3_BCL2L2-      ------------------------tga
A0A4W2GUJ7_BCL2L2-      ------------------------tga
A0A4W2GUJ7_BCL2L2-      ------------------------tga
A0A4W2GUJ7_BCL2L2-      ---------------------------
A0A4W2D6A3_BCL2L2-      gcgacatcatggtattccccttactaa
A0A4W2GUJ7_BCL2L2-      gcgacatcatggtattccccttactaa
A0A4W2GUJ7_BCL2L2-      gcgacatcatggtattccccttactaa

© 1998-2020Legal notice