Dataset for CDS BCL2L2 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      atgggaacggttctcttttctgggcacccactccagggctggaagagttc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aacaagtgcatggaacgtcagagaccttctggaaatgctgaatttactcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aaggtttcatgaggcccagccggcttctcttcacagcctccagggtcaga
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agccctgcctggcccttgatgccctcctggccctgttcttcctggcctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agcagccctcttctttcctgagttgtggctcttcccaagcctgcgtccca
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gccccgcccctctctctggacgcatctctgggccccatcatcacccggcg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ccgggccctccctcccgccccccctttctcctccctccttccttccctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      cttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------

A0A4W2D6A3_BCL2L2-      -----------------------------atggcggcggcggcggcggcg
A0A4W2GUJ7_BCL2L2-      -----------------------------atggcggcggcggcggcggcg
A0A4W2D6A3_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
A0A4W2D6A3_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
A0A4W2GUJ7_BCL2L2-      atcccggcagcggcctgacccccgcccggatggcgaccccagcctcggcc
A0A4W2GUJ7_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
A0A4W2GUJ7_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
A0A4W2D6A3_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
A0A4W2GUJ7_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
A0A4W2GUJ7_BCL2L2-      -----------------------------atggcgaccccagcctcggcc
                                                     ****** *  * **  **** 

A0A4W2D6A3_BCL2L2-      gcagcagcagcgggggct----gcgggcggtcggggctccgggccggggc
A0A4W2GUJ7_BCL2L2-      gcagcagcagcgggggct----gcgggcggtcggggctccgggccggggc
A0A4W2D6A3_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2D6A3_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2GUJ7_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2GUJ7_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2GUJ7_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2D6A3_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2GUJ7_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
A0A4W2GUJ7_BCL2L2-      ccagacaca-cgggctctagtggcagactttgtgggctataagctgaggc
                         ***   ** ****  **    ** * *  *  *****    ** * ***

A0A4W2D6A3_BCL2L2-      ggcggcgccat-cttgtgcccggggccggtggggaggccggggagggggc
A0A4W2GUJ7_BCL2L2-      ggcggcgccat-cttgtgcccggggccggtggggaggccggggagggggc
A0A4W2D6A3_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2D6A3_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2GUJ7_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2GUJ7_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2GUJ7_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2D6A3_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2GUJ7_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
A0A4W2GUJ7_BCL2L2-      agaaggggtatgtttgtggagctggccccggggagggcccagcagctgac
                         *  * *  **  *****     ****   ***  ****  * **  * *

A0A4W2D6A3_BCL2L2-      cccggggggcgcaggggactacgggaacggcttg----gagtctgaggaa
A0A4W2GUJ7_BCL2L2-      cccggggggcgcaggggactacgggaacggcttg----gagtctgaggaa
A0A4W2D6A3_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2D6A3_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2GUJ7_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2GUJ7_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2GUJ7_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2D6A3_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2GUJ7_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
A0A4W2GUJ7_BCL2L2-      cc-----gctacaccaagccatgcgggcagctggagatgagttcga-gac
                        **     *   **     * * * *  * *** *    ****  ** ** 

A0A4W2D6A3_BCL2L2-      ctggagcctgaggagctgct----gctggagcccgagccg-----gagcc
A0A4W2GUJ7_BCL2L2-      ctggagcctgaggagctgct----gctggagcccgagccg-----gagcc
A0A4W2D6A3_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2D6A3_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2GUJ7_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2GUJ7_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2GUJ7_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2D6A3_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2GUJ7_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
A0A4W2GUJ7_BCL2L2-      ccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccc
                        * *   ** * * * ** **     ****   *  *** *     ** **

A0A4W2D6A3_BCL2L2-      cgagcccga---agaggagc--cgccccggcccc------gcgccccccc
A0A4W2GUJ7_BCL2L2-      cgagcccga---agaggagc--cgccccggcccc------gcgccccccc
A0A4W2D6A3_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2D6A3_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2GUJ7_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2GUJ7_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2GUJ7_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2D6A3_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2GUJ7_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
A0A4W2GUJ7_BCL2L2-      cgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaa
                        ** ** **    **    **  * *** ** * *       * *  **  

A0A4W2D6A3_BCL2L2-      gggagctccgg--------gccctg-ggcc-----tggctcgggagcccc
A0A4W2GUJ7_BCL2L2-      gggagctccgg--------gccctg-ggcc-----tggctcgggagcccc
A0A4W2D6A3_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2D6A3_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2GUJ7_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2GUJ7_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2GUJ7_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2D6A3_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2GUJ7_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
A0A4W2GUJ7_BCL2L2-      gggggccccaactggggccgccttgtggccttctttgtctttggagccgc
                        *** ** **          *** ** ****     ** **  ****** *

A0A4W2D6A3_BCL2L2-      ---------------cggcaatcaggaggagga----------ggaggag
A0A4W2GUJ7_BCL2L2-      ---------------cggcaatcaggaggagga----------ggaggag
A0A4W2D6A3_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2D6A3_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2GUJ7_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2GUJ7_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2GUJ7_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2D6A3_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2GUJ7_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
A0A4W2GUJ7_BCL2L2-      gttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaag
                                        * ***  *****  ***          ***  **

A0A4W2D6A3_BCL2L2-      t-cgggactggtcgagggtgacccgggggacggcgc--------------
A0A4W2GUJ7_BCL2L2-      t-cgggactggtcgagggtgacccgggggacggcgc--------------
A0A4W2D6A3_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2D6A3_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2GUJ7_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2GUJ7_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2GUJ7_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2D6A3_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2GUJ7_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
A0A4W2GUJ7_BCL2L2-      tgcaggagtggatggtggcctacctggagacgaggctggctgactggatc
                        * * *** ***  *  **    ** ** ****  **              

A0A4W2D6A3_BCL2L2-      -----cattgaggaccc---------------------------------
A0A4W2GUJ7_BCL2L2-      -----cattgaggaccc---------------------------------
A0A4W2D6A3_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2D6A3_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2GUJ7_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2GUJ7_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2GUJ7_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2D6A3_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2GUJ7_BCL2L2-      cacagcagtgggggctg---------------------------------
A0A4W2GUJ7_BCL2L2-      cacagcagtgggggctggttctcccagaccagtgaagctgagatggttca
                             ** ** ** *                                   

A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      tgaagtatttttcggtgaaattttaagcaactgtgactctgctccaagtt

A0A4W2D6A3_BCL2L2-      -------------ggagctggaagcgatcaaagctcgagttagggagatg
A0A4W2GUJ7_BCL2L2-      -------------ggagctggaagcgatcaaagctcgagttagggagatg
A0A4W2D6A3_BCL2L2-      -------------------ggcggagttcacagctcta--tacggggacg
A0A4W2D6A3_BCL2L2-      -------------------ggcggagttcacagctcta--tacggggacg
A0A4W2GUJ7_BCL2L2-      -------------------ggcggagttcacagctcta--tacggggacg
A0A4W2GUJ7_BCL2L2-      -------------------ggcggagttcacagctcta--tacggggacg
A0A4W2GUJ7_BCL2L2-      -------------ggagctggaagcgatcaaagctcgagttagggagatg
A0A4W2D6A3_BCL2L2-      -------------ggagctggaagcgatcaaagctcgagttagggagatg
A0A4W2GUJ7_BCL2L2-      -------------ggagctggaagcgatcaaagctcgagttagggagatg
A0A4W2GUJ7_BCL2L2-      ctcctgttcctgaggagctggaagcgatcaaagctcgagttagggagatg
                                           **  * * *** ***** *  ** ** ** *

A0A4W2D6A3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaggtagag
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaggtagag
A0A4W2D6A3_BCL2L2-      gggccctggaggaggcgcggcgtctgcgggag---------------ggg
A0A4W2D6A3_BCL2L2-      gggccctggaggaggcgcggcgtctgcgggag---------------ggg
A0A4W2GUJ7_BCL2L2-      gggccctggaggaggcgcggcgtctgcgggag---------------ggg
A0A4W2GUJ7_BCL2L2-      gggccctggaggaggcgcggcgtctgcgggag---------------ggg
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaggtagag
A0A4W2D6A3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaggtagag
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaggtagag
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaggtagag
                        *      *** ** **   *   **   ****               * *

A0A4W2D6A3_BCL2L2-      aagcagatgaatatgagtccacctccgggcaatgctggcccagtgatcat
A0A4W2GUJ7_BCL2L2-      aagcagatgaatatgagtccacctccgggcaatgctggcccagtgatcat
A0A4W2D6A3_BCL2L2-      aa----------------------ctgggc--------------------
A0A4W2D6A3_BCL2L2-      aa----------------------ctgggc--------------------
A0A4W2GUJ7_BCL2L2-      aa----------------------ctgggc--------------------
A0A4W2GUJ7_BCL2L2-      aa----------------------ctgggc--------------------
A0A4W2GUJ7_BCL2L2-      aagcagatgaatatgagtccacctccgggcaatgctggcccagtgatcat
A0A4W2D6A3_BCL2L2-      aagcagatgaatatgagtccacctccgggcaatgctggcccagtgatcat
A0A4W2GUJ7_BCL2L2-      aagcagatgaatatgagtccacctccgggcaatgctggcccagtgatcat
A0A4W2GUJ7_BCL2L2-      aagcagatgaatatgagtccacctccgggcaatgctggcccagtgatcat
                        **                      * ****                    

A0A4W2D6A3_BCL2L2-      gtccattgaggagaa----gatggaggctgatgcccgttccatctatgtt
A0A4W2GUJ7_BCL2L2-      gtccattgaggagaa----gatggaggctgatgcccgttccatctatgtt
A0A4W2D6A3_BCL2L2-      -ttcagtgaggacagtgctgacgggggctg-------------------t
A0A4W2D6A3_BCL2L2-      -ttcagtgaggacagtgctgacgggggctg-------------------t
A0A4W2GUJ7_BCL2L2-      -ttcagtgaggacagtgctgacgggggctg-------------------t
A0A4W2GUJ7_BCL2L2-      -ttcagtgaggacagtgctgacgggggctg-------------------t
A0A4W2GUJ7_BCL2L2-      gtccattgaggagaa----gatggaggctgatgcccgttccatctatgtt
A0A4W2D6A3_BCL2L2-      gtccattgaggagaa----gatggaggctgatgcccgttccatctatgtt
A0A4W2GUJ7_BCL2L2-      gtccattgaggagaa----gatggaggctgatgcccgttccatctatgtt
A0A4W2GUJ7_BCL2L2-      gtccattgaggagaa----gatggaggctgatgcccgttccatctatgtt
                         * ** ****** *     ** ** *****                   *

A0A4W2D6A3_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctagaagcacactttca
A0A4W2GUJ7_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctagaagcacactttca
A0A4W2D6A3_BCL2L2-      ggcactgggggccctggt--------------------------------
A0A4W2D6A3_BCL2L2-      ggcactgggggccctggt--------------------------------
A0A4W2GUJ7_BCL2L2-      ggcactgggggccctggt--------------------------------
A0A4W2GUJ7_BCL2L2-      ggcactgggggccctggt--------------------------------
A0A4W2GUJ7_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctagaagcacactttca
A0A4W2D6A3_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctagaagcacactttca
A0A4W2GUJ7_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctagaagcacactttca
A0A4W2GUJ7_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctagaagcacactttca
                        **** ** ** *  ****                                

A0A4W2D6A3_BCL2L2-      tggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtg
A0A4W2GUJ7_BCL2L2-      tggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtg
A0A4W2D6A3_BCL2L2-      ----------------------------------------aactgtaggg
A0A4W2D6A3_BCL2L2-      ----------------------------------------aactgtaggg
A0A4W2GUJ7_BCL2L2-      ----------------------------------------aactgtaggg
A0A4W2GUJ7_BCL2L2-      ----------------------------------------aactgtaggg
A0A4W2GUJ7_BCL2L2-      tggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtg
A0A4W2D6A3_BCL2L2-      tggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtg
A0A4W2GUJ7_BCL2L2-      tggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtg
A0A4W2GUJ7_BCL2L2-      tggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtg
                                                                ** * *** *

A0A4W2D6A3_BCL2L2-      gccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtg
A0A4W2GUJ7_BCL2L2-      gccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtg
A0A4W2D6A3_BCL2L2-      gcctt---------------------------------------------
A0A4W2D6A3_BCL2L2-      gcctt---------------------------------------------
A0A4W2GUJ7_BCL2L2-      gcctt---------------------------------------------
A0A4W2GUJ7_BCL2L2-      gcctt---------------------------------------------
A0A4W2GUJ7_BCL2L2-      gccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtg
A0A4W2D6A3_BCL2L2-      gccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtg
A0A4W2GUJ7_BCL2L2-      gccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtg
A0A4W2GUJ7_BCL2L2-      gccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtg
                        *** *                                             

A0A4W2D6A3_BCL2L2-      aggacttccctggccttagatgaatccttatttagaggaagacagatcaa
A0A4W2GUJ7_BCL2L2-      aggacttccctggccttagatgaatccttatttagaggaagacagatcaa
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aggacttccctggccttagatgaatccttatttagaggaagacagatcaa
A0A4W2D6A3_BCL2L2-      aggacttccctggccttagatgaatccttatttagaggaagacagatcaa
A0A4W2GUJ7_BCL2L2-      aggacttccctggccttagatgaatccttatttagaggaagacagatcaa
A0A4W2GUJ7_BCL2L2-      aggacttccctggccttagatgaatccttatttagaggaagacagatcaa

A0A4W2D6A3_BCL2L2-      ggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgag
A0A4W2GUJ7_BCL2L2-      ggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgag
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgag
A0A4W2D6A3_BCL2L2-      ggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgag
A0A4W2GUJ7_BCL2L2-      ggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgag
A0A4W2GUJ7_BCL2L2-      ggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgag

A0A4W2D6A3_BCL2L2-      gcttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcc
A0A4W2GUJ7_BCL2L2-      gcttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcc
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gcttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcc
A0A4W2D6A3_BCL2L2-      gcttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcc
A0A4W2GUJ7_BCL2L2-      gcttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcc
A0A4W2GUJ7_BCL2L2-      gcttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcc

A0A4W2D6A3_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
A0A4W2GUJ7_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
A0A4W2D6A3_BCL2L2-      --------------------ttttgctagcaag-----------------
A0A4W2D6A3_BCL2L2-      --------------------ttttgctagcaag-----------------
A0A4W2GUJ7_BCL2L2-      --------------------ttttgctagcaag-----------------
A0A4W2GUJ7_BCL2L2-      --------------------ttttgctagcaag-----------------
A0A4W2GUJ7_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
A0A4W2D6A3_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
A0A4W2GUJ7_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
A0A4W2GUJ7_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
                                            ****   **** *                 

A0A4W2D6A3_BCL2L2-      ca--ggtcaggatag----------------------------
A0A4W2GUJ7_BCL2L2-      ca--ggtcaggatag----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------------------tga
A0A4W2D6A3_BCL2L2-      ----------------------------------------tga
A0A4W2GUJ7_BCL2L2-      ----------------------------------------tga
A0A4W2GUJ7_BCL2L2-      ----------------------------------------tga
A0A4W2GUJ7_BCL2L2-      ca--ggtcaggatag----------------------------
A0A4W2D6A3_BCL2L2-      caggggccgggctagagcgacatcatggtattccccttactaa
A0A4W2GUJ7_BCL2L2-      caggggccgggctagagcgacatcatggtattccccttactaa
A0A4W2GUJ7_BCL2L2-      caggggccgggctagagcgacatcatggtattccccttactaa

© 1998-2023Legal notice