Dataset for CDS BCL2A1 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2DYC0_BCL2A1-      atg----------------------------actg--------acactga
A0A4W2DYC0_BCL2A1-      atggaaaaggaatttgaagatggcattgttaactg--------gggcagg
A0A4W2DYC0_BCL2A1-      atggcggcagcggtggccgtgagcggcgccaagcggagcctgcgggccga
                        ***                            *  *           * * 

A0A4W2DYC0_BCL2A1-      gtt-tggctacgttcacgggc-------------tggctgagga------
A0A4W2DYC0_BCL2A1-      attgtaaccatattcgc---ctttgaaggtattcttaccaagaaacttct
A0A4W2DYC0_BCL2A1-      gctgaagcagcgtctgcgggcgctgagcg--------ctgaggagcggct
                          *    *    *   *   *                *  ** *      

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      gggcaagtgtattgcctcagacatggacatgtgcaaggacatttctttct
A0A4W2DYC0_BCL2A1-      gcgccag------------------------------------tcccacc

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      ttgtggcggagttcatcaccgaaaatacaggagagtggataaagcaaaat
A0A4W2DYC0_BCL2A1-      tcttggc-----------ccagaa--------------------------

A0A4W2DYC0_BCL2A1-      -------------ctatctgaaatatgtgttgcagatacagcaacctg--
A0A4W2DYC0_BCL2A1-      ggaggctgggtgtttacccataatgaatatcaaaagtccaaaagagtgtc
A0A4W2DYC0_BCL2A1-      --------ggtgtttacccataatgaatatcaaaagtccaaaagagtgtc
                                      ** *   ***   * *   *  * **  *   **  

A0A4W2DYC0_BCL2A1-      ------------------------gatccaagccaagcaaaacatccagg
A0A4W2DYC0_BCL2A1-      catctttctgagcatgccagatgaaattgagacagaggagatcatcaagg
A0A4W2DYC0_BCL2A1-      catctttctgagcatgccagatgaaattgagacagaggagatcatcaagg
                                                 **  *  *  ** * * **** ***

A0A4W2DYC0_BCL2A1-      gtgtt-----acaagatgtggcttcctctgtc---caggacgaagtggaa
A0A4W2DYC0_BCL2A1-      acattttccgacaaggcaaaacctgctttatcccgcggtaccagttgcag
A0A4W2DYC0_BCL2A1-      acattttccgacaaggcaaaacctgctttatcccgcggtaccagttgcag
                           **     *****      * * ** * **   * * ** *  ** * 

A0A4W2DYC0_BCL2A1-      aggactctgaagcagtgcttggataagtttgatgtggtgtccgtaga---
A0A4W2DYC0_BCL2A1-      agcaatc---------acatggatatggtgaagttagcatcgccagagga
A0A4W2DYC0_BCL2A1-      agcaatc---------acatggatatggtgaagttagcatcgccagagga
                        ** * **          * ****** * *  *  * *  **   ***   

A0A4W2DYC0_BCL2A1-      --------cactg-ccagaac-------aatattcaaccaagtgatggaa
A0A4W2DYC0_BCL2A1-      aatcgctttgctgcccagaacttcctggaacattcagcagcccggtgagg
A0A4W2DYC0_BCL2A1-      aatcgctttgctgcccagaacttcctggaacattcagcagcccggtgagg
                                  *** *******       ** ***** *     * **   

A0A4W2DYC0_BCL2A1-      aaggaatt-tgaagatggcattgttaactggggcaggattgtaaccatat
A0A4W2DYC0_BCL2A1-      atgaagttctggaggaggccttgtcaacagggg--gacttgacctcatct
A0A4W2DYC0_BCL2A1-      atgaagttctggaggaggccttgtcaacagggg--gacttgacctcatct
                        * * * ** ** **  *** **** *** ****  *  ***    *** *

A0A4W2DYC0_BCL2A1-      tcgcctttgaaggtattcttaccaagaaacttctgggcaagtgtattgcc
A0A4W2DYC0_BCL2A1-      tcgtgcc---gggtctcgggttcgacaaa---cagagcaaccgtttggga
A0A4W2DYC0_BCL2A1-      tcgtgcc---gggtctcgggttcgacaaa---cagagcaaccgtttggga
                        ***        *** *      * * ***   * * ****  ** * *  

A0A4W2DYC0_BCL2A1-      tcagacatggacatgtgcaaggacatttctttctttgtggcggagttcat
A0A4W2DYC0_BCL2A1-      cggggcaagggc---tactatgacgcctacct---------gaag--cgt
A0A4W2DYC0_BCL2A1-      cggggcaagggc---tactatgacgcctacct---------gaag--cgt
                           * ** ** *   * * * ***   *   *         * **  * *

A0A4W2DYC0_BCL2A1-      caccgaaaatacaggagagtggataaagcaaaatggaggctgggaaaatg
A0A4W2DYC0_BCL2A1-      tgtctgcagtcccaggacgtga--aaccctacaccctggcc-------tt
A0A4W2DYC0_BCL2A1-      tgtctgcagtcccaggacgtga--aaccctacaccctggcc-------tt
                           *   * * *  *   ***   **  * * *    ***        * 

A0A4W2DYC0_BCL2A1-      ggtttgtaaag---aagtttgaaaccaaatctggctggctgacttttctg
A0A4W2DYC0_BCL2A1-      ggctttcaaagagcagatctgcctccaggtcccggtgaatgagaatgatg
A0A4W2DYC0_BCL2A1-      ggctttcaaagagcagatctgcctccaggtcccggtgaatgagaatgatg
                        ** **  ****   *  * **   ***  **  * **  ***   *  **

A0A4W2DYC0_BCL2A1-      -gaagttacaggaaagatctgtgaaacattatgtcgcctgaagcaatact
A0A4W2DYC0_BCL2A1-      tgaaggtagacga---------ggtgctttacg-----------aagact
A0A4W2DYC0_BCL2A1-      tgaaggtagacga---------ggtgctttacg-----------aagact
                         **** ** * **         *   * *** *           ** ***

A0A4W2DYC0_BCL2A1-      attga
A0A4W2DYC0_BCL2A1-      cctga
A0A4W2DYC0_BCL2A1-      cctga

© 1998-2020Legal notice