Dataset for CDS BCL-2 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2BWN1_BCL2-01      atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaa
A0A4W2BWN1_BCL2-02      atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaa

A0A4W2BWN1_BCL2-01      gtacatccactataagctgtcgcagcggggctacgagtgggatgccggag
A0A4W2BWN1_BCL2-02      gtacatccactataagctgtcgcagcggggctacgagtgggatgccggag

A0A4W2BWN1_BCL2-01      acgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc
A0A4W2BWN1_BCL2-02      acgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc

A0A4W2BWN1_BCL2-01      tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc
A0A4W2BWN1_BCL2-02      tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc

A0A4W2BWN1_BCL2-01      cccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgc
A0A4W2BWN1_BCL2-02      cccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgc

A0A4W2BWN1_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A4W2BWN1_BCL2-02      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc

A0A4W2BWN1_BCL2-01      gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag
A0A4W2BWN1_BCL2-02      gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgag

A0A4W2BWN1_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A4W2BWN1_BCL2-02      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact

A0A4W2BWN1_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
A0A4W2BWN1_BCL2-02      gggggcgcatcgtggccttctttgagttcggaggggtcatgtg-------

A0A4W2BWN1_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacagcatcgccctgtggat
A0A4W2BWN1_BCL2-02      -------------------------------------------tgtggat

A0A4W2BWN1_BCL2-01      gaccgagtacctgaaccggcacctgcacacctggatccaggacaacggag
A0A4W2BWN1_BCL2-02      gaccgagtacctgaaccggcacctgcacacctggatccaggacaacggag

A0A4W2BWN1_BCL2-01      gctgg---gacgcctttgtggagctgtatggccctagcatgcggcccctg
A0A4W2BWN1_BCL2-02      gctgggtaggtgctcgtctggatgtg---agtctgagcgggacacctcgg
                        *****   *  **   * ****  **    * *  ***  *   ** * *

A0A4W2BWN1_BCL2-01      tttgatttctcctggctgtctctgaaggcactgctcagtctggccc---t
A0A4W2BWN1_BCL2-02      t--------------------------------cccagtgcggtccgagt
                        *                                * ****  ** **   *

A0A4W2BWN1_BCL2-01      ggtgggcgcttgcatcaccctgggtgcctatctgggccat-aagtga
A0A4W2BWN1_BCL2-02      ggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
                        ******   * **    *** ****      * ** *  *  *** *

© 1998-2021Legal notice