Dataset for CDS BAX-like of Organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4L686_BAX-01       atggacgggtccggggagcaacccaga--------ggcggggg-------
A0A8C4L686_BAX-02       atggacgggtccggggagcaacccaga--------ggcggggggcccacc
A0A8C4LJY5_BOK-01       atgga--ggtgctgcggcgctcctcggtcttcgccgccgagat-------
A0A8C4MQG4_BAK1-01      atggc--gtccgggcaagg--cccaggtcctccggggaaggag-------
A0A8C4MQG4_BAK1-02      atggc--gtccgggcaagg--cccaggtcctccggggaaggag-------
                        ****   *     *       **  *         *    *         

A0A8C4L686_BAX-01       --------------------------------------------------
A0A8C4L686_BAX-02       agctctgagcagatcatgaagacaggggcccttttgcttcagggtttcat
A0A8C4LJY5_BOK-01       --------------------catggacgcctttgaccgctcgcccaccga
A0A8C4MQG4_BAK1-01      --------------------tgcgga-gagcctgccccgtcctccacttc
A0A8C4MQG4_BAK1-02      --------------------tgcgga-gagcctgccccgtcctccacttc
                                                                          

A0A8C4L686_BAX-01       tgaggatc-----gcgcgggg---------cggatggggggagacacacc
A0A8C4L686_BAX-02       ccaggatc-----gcgcgggg---------cggatggggggagacacacc
A0A8C4LJY5_BOK-01       caaggagctggtggcccaggccaaggcgctcggcagggagttcgtgcacg
A0A8C4MQG4_BAK1-01      tgaggagcaggtagcccgggaca-------cggaggaggttttccgcagc
A0A8C4MQG4_BAK1-02      tgaggagcaggtagcccgggaca-------cggaggaggttttccgcagc
                          **** *     ** * **          ***  * *        **  

A0A8C4L686_BAX-01       cgagctgg---------------gcctggaggaggtgccccaggatgcgt
A0A8C4L686_BAX-02       cgagctgg---------------gcctggaggaggtgccccaggatgcgt
A0A8C4LJY5_BOK-01       cgcggctgctgcgcgctggcctcgcctggagc--gcgcccgagcgtgccg
A0A8C4MQG4_BAK1-01      tacgtttatt----accgccaccagcaggagcaggaggccgagggggcgg
A0A8C4MQG4_BAK1-02      tacgtttatt----accgccaccagcaggagcaggaggccgagggggcgg
                           *                     * ****   * * ** **   **  

A0A8C4L686_BAX-01       ccacca------------------agaagctgagcg-agtgtctca----
A0A8C4L686_BAX-02       ccacca------------------agaagctgagcg-agtgtctca----
A0A8C4LJY5_BOK-01       cccctgcccccggcggccgcctggcagaggtgtgcgcggtgctgct----
A0A8C4MQG4_BAK1-01      ---ctgcgcccgcagacc------cagagatggacaccctgcccctggaa
A0A8C4MQG4_BAK1-02      ---ctgcgcccgcagacc------cagagatggacaccctgcccctggaa
                           *                       ** **  *    **   *     

A0A8C4L686_BAX-01       ------agcgcatcggagatgagctgga---------------------c
A0A8C4L686_BAX-02       ------agcgcatcggagatgagctgga---------------------c
A0A8C4LJY5_BOK-01       -------gcgcctgggagatgagctggagctgatccggcccagtgtctac
A0A8C4MQG4_BAK1-01      cctaacagcaccatggggc--aggtggggcgg---cagctcgccgtcatc
A0A8C4MQG4_BAK1-02      cctaacagcaccatggggc--aggtggggcgg---cagctcgccgtcatc
                               ** *   ** *   ** ***                      *

A0A8C4L686_BAX-01       agtaacatgg------agctgcagag------gatgattgcggccgtgga
A0A8C4L686_BAX-02       agtaacatgg------agctgcagag------gatgattgcggccgtgga
A0A8C4LJY5_BOK-01       cgcaacgtggctcgccagctgaacatctcactgcagtctgagaccgtggt
A0A8C4MQG4_BAK1-01      ggggacgacatcaatcggcgctacgactc---ggagttccagaccatgct
A0A8C4MQG4_BAK1-02      ggggacgacatcaatcggcgctacgactc---ggagttccagaccatgct
                         *  **           **   *         *  *     * ** **  

A0A8C4L686_BAX-01       cacggactccccccgc--------gaggtctttttccgagtggcagctga
A0A8C4L686_BAX-02       cacggactccccccgc--------gaggtctttttccgagtggcagctga
A0A8C4LJY5_BOK-01       gactgacgccttc--ctggctg------------------tgtctgccca
A0A8C4MQG4_BAK1-01      ga--agcacctgcagccgacagcagagaacgcctatgagctgttcaccaa
A0A8C4MQG4_BAK1-02      ga--agcacctgcagccgacagcagagaacgcctatgagctgttcaccaa
                         *    * **  *  *                        **    *  *

A0A8C4L686_BAX-01       gatgttttcc-----------------------------gacggc-aact
A0A8C4L686_BAX-02       gatgttttcc-----------------------------gacggc-aact
A0A8C4LJY5_BOK-01       gatcttctct---------------------------------gcaggca
A0A8C4MQG4_BAK1-01      gatcgcctcg--------------------agcctgtttgagagc-ggca
A0A8C4MQG4_BAK1-02      gatcgcctcgaggccagcagcaacacccacagcctgtttgagagc-ggca
                        ***    **                                  **   * 

A0A8C4L686_BAX-01       tcaactggggccgggttgttgcccttttctactttgccagcaaattggtg
A0A8C4L686_BAX-02       tcaactggggccgggttgttgcccttttctactttgccagcaaattggtg
A0A8C4LJY5_BOK-01       tcacgtggggcaaggtggtg----tccctgtacttggtggctg--cgggg
A0A8C4MQG4_BAK1-01      tcaactggggccgagtggtggctctcctggggttcggctaccg--c----
A0A8C4MQG4_BAK1-02      tcaactggggccgagtggtggctctcctggggttcggctaccg--c----
                        ***  ******   ** **     *        * *    *         

A0A8C4L686_BAX-01       ctcaaggcc-----ctgtgcaccaaggtgcccgagctgatcaggaccat-
A0A8C4L686_BAX-02       ctcaaggcc-----ctgtgcaccaaggtgcccgagctgatcaggaccat-
A0A8C4LJY5_BOK-01       ct---ggccgtggactgcgtg-cggcaggcccagcccgccatggtccatg
A0A8C4MQG4_BAK1-01      ct---ggcc-----ctgcatgtctaccagcgcggcctgaccggcttcctg
A0A8C4MQG4_BAK1-02      ct---ggcc-----ctgcatgtctaccagcgcggcctga-----------
                        **   ****     ***     *     ** *   * *            

A0A8C4L686_BAX-01       ----catgggctggacactggacttccttcgagagcggctgctgggctgg
A0A8C4L686_BAX-02       ----catgggctggacactggacttccttcgagagcggctgctgggctgg
A0A8C4LJY5_BOK-01       ctctcgttgactgcctcggggagtttgtgcgcaagaccctggcgacctgg
A0A8C4MQG4_BAK1-01      agccagttgacccgcttcgtggctgaattcatgctgcatcactgcattgc
A0A8C4MQG4_BAK1-02      --------------------------------------------------
                                                                          

A0A8C4L686_BAX-01       atccaggaccagggtggttgggtgaggcctctgggacccctgagcccacc
A0A8C4L686_BAX-02       atccaggaccagggtggttgg-----------------------------
A0A8C4LJY5_BOK-01       ctgcggaggcgtggcggatggactgacgtcctcaagtgtgtg--------
A0A8C4MQG4_BAK1-01      ccggtggatcgcacagagggg-----------cggctgggtg--------
A0A8C4MQG4_BAK1-02      --------------------------------------------------
                                                                          

A0A8C4L686_BAX-01       accgagacggcctcctctccgactttgggtcacccacgtggcagacagtg
A0A8C4L686_BAX-02       -----gacggcctcctctccgactttgggtcacccacgtggcagacagtg
A0A8C4LJY5_BOK-01       -----gtcagcacggaccccggctaccgctcccattggctcgtggctgcg
A0A8C4MQG4_BAK1-01      -----gcggctctggacttgggaaatggccccatccggaatgtgctgata
A0A8C4MQG4_BAK1-02      --------------------------------------------------
                                                                          

A0A8C4L686_BAX-01       accatcttcgtggccggagtgctcaccgcctcgctcaccatctggaagaa
A0A8C4L686_BAX-02       accatcttcgtggccggagtgctcaccgcctcgctcaccatctggaagaa
A0A8C4LJY5_BOK-01       ttctgcagtgtcggccgcttcctgaaggctgccttcttcatgctgttgcc
A0A8C4MQG4_BAK1-01      gttctggctgtggttctgttgggccagtatgtggtacgaagattctt---
A0A8C4MQG4_BAK1-02      --------------------------------------------------
                                                                          

A0A8C4L686_BAX-01       gatgggctgaggccaccagctgccttggactgtgactcttctgcataa
A0A8C4L686_BAX-02       gatgggctga--------------------------------------
A0A8C4LJY5_BOK-01       agagagatga--------------------------------------
A0A8C4MQG4_BAK1-01      caagtcatga--------------------------------------
A0A8C4MQG4_BAK1-02      ------------------------------------------------
                                                                        

© 1998-2023Legal notice