Dataset for CDS BAX of Organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4L686_BAX-01      atggacgggtccggggagcaacccagaggcggggg---------------
A0A8C4L686_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
                       ***********************************               

A0A8C4L686_BAX-01      ------------------------------------------tgaggatc
A0A8C4L686_BAX-02      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                                                                   ******

A0A8C4L686_BAX-01      gcgcggggcggatggggggagacacacccgagctgggcctggaggaggtg
A0A8C4L686_BAX-02      gcgcggggcggatggggggagacacacccgagctgggcctggaggaggtg
                       **************************************************

A0A8C4L686_BAX-01      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A8C4L686_BAX-02      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
                       **************************************************

A0A8C4L686_BAX-01      agatgagctggacagtaacatggagctgcagaggatgattgcggccgtgg
A0A8C4L686_BAX-02      agatgagctggacagtaacatggagctgcagaggatgattgcggccgtgg
                       **************************************************

A0A8C4L686_BAX-01      acacggactccccccgcgaggtctttttccgagtggcagctgagatgttt
A0A8C4L686_BAX-02      acacggactccccccgcgaggtctttttccgagtggcagctgagatgttt
                       **************************************************

A0A8C4L686_BAX-01      tccgacggcaacttcaactggggccgggttgttgcccttttctactttgc
A0A8C4L686_BAX-02      tccgacggcaacttcaactggggccgggttgttgcccttttctactttgc
                       **************************************************

A0A8C4L686_BAX-01      cagcaaattggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
A0A8C4L686_BAX-02      cagcaaattggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
                       **************************************************

A0A8C4L686_BAX-01      ggaccatcatgggctggacactggacttccttcgagagcggctgctgggc
A0A8C4L686_BAX-02      ggaccatcatgggctggacactggacttccttcgagagcggctgctgggc
                       **************************************************

A0A8C4L686_BAX-01      tggatccaggaccagggtggttgggtgaggcctctgggacccctgagccc
A0A8C4L686_BAX-02      tggatccaggaccagggtggttgg--------------------------
                       ************************                          

A0A8C4L686_BAX-01      accaccgagacggcctcctctccgactttgggtcacccacgtggcagaca
A0A8C4L686_BAX-02      --------gacggcctcctctccgactttgggtcacccacgtggcagaca
                               ******************************************

A0A8C4L686_BAX-01      gtgaccatcttcgtggccggagtgctcaccgcctcgctcaccatctggaa
A0A8C4L686_BAX-02      gtgaccatcttcgtggccggagtgctcaccgcctcgctcaccatctggaa
                       **************************************************

A0A8C4L686_BAX-01      gaagatgggctgaggccaccagctgccttggactgtgactcttctgcata
A0A8C4L686_BAX-02      gaagatgggctga-------------------------------------
                       *************                                     

A0A8C4L686_BAX-01      a
A0A8C4L686_BAX-02      -
                        

© 1998-2023Legal notice