Dataset for CDS BAX-like of Organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5Q7S1_BAX-03       ------------------------------------------atggacgg
A0A2K5Q7S1_BAX-02       ------------------------------------------atggacgg
A0A2K5QZM8_BOK-01       atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgc
A0A2K5SIP9_BAK1-01      atggcatcggggcaaggcccag--gtcctcccaggcaggagtgtgga-ga
                                                                   **** * 

A0A2K5Q7S1_BAX-03       gtccggggagcagccca-----gaggcgaggggcccaccagctctgagca
A0A2K5Q7S1_BAX-02       gtccggggagcagccca-----gaggcgaggg------------------
A0A2K5QZM8_BOK-01       ctttgaccgctcgcccacggacaaggagctgg------tggcccaggcca
A0A2K5SIP9_BAK1-01      gtctgacccaccctctgcttctgaggcgcagg------tagcccgggaca
                         *  *         *        *** *  **                  

A0A2K5Q7S1_BAX-03       gatcatgaagacaggggcccttttgcttcagggtttcatccaggatcgag
A0A2K5Q7S1_BAX-02       -----tgaggcgggaggc------------------------------ag
A0A2K5QZM8_BOK-01       aggcgctgggccgggagttcgtgcacg--------------cgcggctgc
A0A2K5SIP9_BAK1-01      cgg---------aggaggttttccacagctacgttttttaccgccaccag
                                     *  *                                 

A0A2K5Q7S1_BAX-03       cag-----ggcgaatcgggggggaggcac-------ccgagctggccctg
A0A2K5Q7S1_BAX-02       tcg-----ggcggaaggagggcga-gcac-------ccgagctggccctg
A0A2K5QZM8_BOK-01       tgcgcgccggcctctcctggagcgcccccgagcgcgccgcgccggtcccg
A0A2K5SIP9_BAK1-01      caggaacaggaggctgaaggggcggccgc-------ccctgctgacccgg
                                **        **      * *       **  ** *  ** *

A0A2K5Q7S1_BAX-03       gacccggtgccccaggatgcgtcc-----------accaagaagctgagc
A0A2K5Q7S1_BAX-02       gacccggtgccccaggatgcgtcc-----------accaagaagctgagc
A0A2K5QZM8_BOK-01       gggcgcctggcc---gaggtgtgc------gccgtgctgctgcgcctggg
A0A2K5SIP9_BAK1-01      agatggtcagct---tgtctctccaacctagcagcaccatggggcaggtg
                                  *          * *            *      **     

A0A2K5Q7S1_BAX-03       gagtg---tctcaagcgcatcggggacgaactggacag------caacat
A0A2K5Q7S1_BAX-02       gagtg---tctcaagcgcatcggggacgaactggacag------caacat
A0A2K5QZM8_BOK-01       ggatg--agctggagatgatccggcccagcatctaccg------caacgt
A0A2K5SIP9_BAK1-01      ggacggcagctcgccatcattggggatgacatcaaccggcgctatgactc
                        *   *    **       **  **       *  ** *        **  

A0A2K5Q7S1_BAX-03       gga------------gctgcagaggatgattgccactgtggacacaaact
A0A2K5Q7S1_BAX-02       gga------------gctgcagaggatgattgccactgtggacacaaact
A0A2K5QZM8_BOK-01       ggcgcacca------gctgca-catctccctgcagtctgagcccgtggtg
A0A2K5SIP9_BAK1-01      ggagttccaggccatgctgcagca----cctgcagcccacggcagagaac
                        **             ******         ***       * *       

A0A2K5Q7S1_BAX-03       ccccccgagaggtcttttttcgagtggcagctgacatgttctctgacggc
A0A2K5Q7S1_BAX-02       ccccccgagaggtcttttttcgagtggcagctgacatgttctctgacggc
A0A2K5QZM8_BOK-01       accgacgcg-----ttcctggccgtggctggccacatcttctccgca---
A0A2K5SIP9_BAK1-01      gcctatgag-----tacttcaccaagatcgcctccagcctgtttgagagt
                         **   * *     *   *      *   *    **   * *  *     

A0A2K5Q7S1_BAX-03       aacttcaactggggccgggttgtcgcctttttctactttgccagca-aac
A0A2K5Q7S1_BAX-02       aacttcaactggggccgggttgtcgcctttttctactttgccagca-aac
A0A2K5QZM8_BOK-01       ggcatcacgtggggcaaggtggtgtccct-gtatgcggtggcggcagggc
A0A2K5SIP9_BAK1-01      ggcatcaactggggccgtgtggtggctctcctgggcttcggctacc-gtc
                          * ***  ******   ** **  *  *  *   *   * *  *    *

A0A2K5Q7S1_BAX-03       tggtgctcaag---------------------------------------
A0A2K5Q7S1_BAX-02       tggtgctcaaggtgggcagctgcagggcagtgagcccagggattcaaacc
A0A2K5QZM8_BOK-01       tggccgtggactgcgtgag------------------gcaggcccagcct
A0A2K5SIP9_BAK1-01      tggccctacac-----------------------------------gtct
                        ***   *  *                                        

A0A2K5Q7S1_BAX-03       ---------------------gatagcct---------------------
A0A2K5Q7S1_BAX-02       atcataagctggggactgtctgatagcct---------------------
A0A2K5QZM8_BOK-01       gccatggtccacgcccttgttgactgcctgggagag---------tttgt
A0A2K5SIP9_BAK1-01      accag----cgcggcctgactggcttcctgggccaggtgacccgcttcgt
                                             *    ***                     

A0A2K5Q7S1_BAX-03       --------cctctcctactttgggacacccacatggcagac---agtga-
A0A2K5Q7S1_BAX-02       --------cctctcctactttgggacacccacatggcagac---agtga-
A0A2K5QZM8_BOK-01       gcgcaagactctggccacctggctgcggaggcgcggtggat-ggactgat
A0A2K5SIP9_BAK1-01      g-gtggacttcatgctgcatcactgcatc-gcccggtggatcgcacagag
                                      *  * *     *     *  **  **    *  ** 

A0A2K5Q7S1_BAX-03       ----ccatctttgtgg-ctggagtgctcaccgcctcacttaccat-----
A0A2K5Q7S1_BAX-02       ----ccatctttgtgg-ctggagtgctcaccgcctcacttaccat-----
A0A2K5QZM8_BOK-01       gtcctcaagtgtgtggtcagcacagaccccagcctccgctccca------
A0A2K5SIP9_BAK1-01      gg--gcggctgggtgg-cagccctggacttgggcaatggtcccatcctga
                             *   *  **** * *    *  *   * *     * ***      

A0A2K5Q7S1_BAX-03       -----ctggaag---------------aacatgggc--------------
A0A2K5Q7S1_BAX-02       -----ctggaag---------------aacatgggc--------------
A0A2K5QZM8_BOK-01       -----ctggctgctcaccgcactctgcagcttcggccgcttcctgaaggc
A0A2K5SIP9_BAK1-01      atgtgctggtggttctgggtgtggttctg-ttgggccagtttgtggtacg
                             ****  *                   * ***              

A0A2K5Q7S1_BAX-03       ----------------------------tga
A0A2K5Q7S1_BAX-02       ----------------------------tga
A0A2K5QZM8_BOK-01       tgccttcttcgtgctcctgccagagagatga
A0A2K5SIP9_BAK1-01      aagattcttc------------aaatcatga

© 1998-2020Legal notice