Dataset for CDS BAX of Organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5Q7S1_BAX-03      atggacgggtccggggagcagcccagaggcgaggggcccaccagctctga
A0A2K5Q7S1_BAX-02      atggacgggtccggggagcagcccagaggcgaggg---------------
                       ***********************************               

A0A2K5Q7S1_BAX-03      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5Q7S1_BAX-02      --------tgaggcgggaggc-----------------------------
                               *** *   * ***                             

A0A2K5Q7S1_BAX-03      gagcagggcgaatcgggggggaggcacccgagctggccctggacccggtg
A0A2K5Q7S1_BAX-02      -agtcgggcggaaggagggcga-gcacccgagctggccctggacccggtg
                        **  ***** *  * *** ** ***************************

A0A2K5Q7S1_BAX-03      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2K5Q7S1_BAX-02      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
                       **************************************************

A0A2K5Q7S1_BAX-03      ggacgaactggacagcaacatggagctgcagaggatgattgccactgtgg
A0A2K5Q7S1_BAX-02      ggacgaactggacagcaacatggagctgcagaggatgattgccactgtgg
                       **************************************************

A0A2K5Q7S1_BAX-03      acacaaactccccccgagaggtcttttttcgagtggcagctgacatgttc
A0A2K5Q7S1_BAX-02      acacaaactccccccgagaggtcttttttcgagtggcagctgacatgttc
                       **************************************************

A0A2K5Q7S1_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcctttttctactttgc
A0A2K5Q7S1_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcctttttctactttgc
                       **************************************************

A0A2K5Q7S1_BAX-03      cagcaaactggtgctcaag-------------------------------
A0A2K5Q7S1_BAX-02      cagcaaactggtgctcaaggtgggcagctgcagggcagtgagcccaggga
                       *******************                               

A0A2K5Q7S1_BAX-03      -----------------------------gatagcctcctctcctacttt
A0A2K5Q7S1_BAX-02      ttcaaaccatcataagctggggactgtctgatagcctcctctcctacttt
                                                    *********************

A0A2K5Q7S1_BAX-03      gggacacccacatggcagacagtgaccatctttgtggctggagtgctcac
A0A2K5Q7S1_BAX-02      gggacacccacatggcagacagtgaccatctttgtggctggagtgctcac
                       **************************************************

A0A2K5Q7S1_BAX-03      cgcctcacttaccatctggaagaacatgggctga
A0A2K5Q7S1_BAX-02      cgcctcacttaccatctggaagaacatgggctga
                       **********************************

© 1998-2020Legal notice