Dataset for CDS BAX-like of Organism Anser cygnoid

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9EM33_BAK1-01      atggggaacgacggagacccaccgggggcccacggacgccggggcagcaa
A0A8B9IHS5_BOK-01       ----------atggaagtgcttcgccgatcctcagtcttcgctgcagagg
                                  * ***    *  **  *  ** * * *  **  ****   

A0A8B9EM33_BAK1-01      tgggcgcaggctgtcacaagagctcaattcagaagaccaggtggccca-g
A0A8B9IHS5_BOK-01       tgatgg-----------aggtgttcga----------caggtctcccact
                        **   *           * * * ** *          *****  ****  

A0A8B9EM33_BAK1-01      gagaccgaggaggtgtttcggagctacgccttctaccgctaccaacagga
A0A8B9IHS5_BOK-01       gacaaggagcttgtgtcccaagctaaggccctctgcagagactac----a
                        ** *  ***   ****  *      * *** *** * *  ** *     *

A0A8B9EM33_BAK1-01      gagagaagagagtggggaagaagtgcccttggacccggagattgcagaga
A0A8B9IHS5_BOK-01       taaattcgaggctgg-------------ttcgagcaggtgtcagctgg--
                         * *   ***  ***             ** ** * ** *   ** *   

A0A8B9EM33_BAK1-01      tccagcaagagctgggcagcaccg----ggagcctggtggggaggcgcc-
A0A8B9IHS5_BOK-01       ---agca--aacctgacggcaatgcgccggtgcctggcggtaagctggcc
                           ****  * *  * * ***  *    ** ****** **  **  * * 

A0A8B9EM33_BAK1-01      ----tggccatcat-------cggcgatgacatta--------acaagcg
A0A8B9IHS5_BOK-01       gaggtgtccaccatactgctgcggctgggagatgagctggaatacattcg
                            ** *** ***       ****   ** ** *        ***  **

A0A8B9EM33_BAK1-01      gtacgacgcc-----gagtttcg-ctacatgctgaaatccttgcagccca
A0A8B9IHS5_BOK-01       ccccaacgtctaccggaatatcgcccgccagctgaacatctcgctgcac-
                           * *** *     ** * *** *  *  ******   ** ** ** * 

A0A8B9EM33_BAK1-01      ccaaggagaatgcctacgagta-cttcaccacgatcgcctccagcctgtt
A0A8B9IHS5_BOK-01       tcggagacggtggtgacggacgccttcctggctgtagcggcgcagatttt
                         *   **   **   ***     ****    *  * **  *     * **

A0A8B9EM33_BAK1-01      cgaaagcggcattaactggggccgggtgatcgcgctgctgggcttcggct
A0A8B9IHS5_BOK-01       caccgcaggcataacatggggcaaggtggtgtctct-ctacgcggtggca
                        *      ***** *  ******  **** *  * ** **  **   *** 

A0A8B9EM33_BAK1-01      actgca-tggccatccacgtctaccagcacggcataacgggct-tcctcc
A0A8B9IHS5_BOK-01       gcggggctggcggtggactgcgtgcggcac-gcacagccagccatggttc
                         * *   ****  *  **  *   * **** *** * *  **  *  * *

A0A8B9EM33_BAK1-01      gccgcatcgcccgcttcgtgacggagttcatgctgcgcaaccgcatcgcc
A0A8B9IHS5_BOK-01       acaccatcgtcgactgcctgggagagttcgt-ccgcaagaccttggtgac
                         *  ***** *  ** * **   ****** * * **   ***     * *

A0A8B9EM33_BAK1-01      cagtggatcgcccagcaaggaggatgggt-gacgtggggcagagtggct-
A0A8B9IHS5_BOK-01       --atggctgaaaaggcgaggaggctgggcagacatcacgaagtgtgttgt
                           *** *      ** ****** ****  *** *   * ** ***    

A0A8B9EM33_BAK1-01      --gcactcgatctggacaatgtttacatgaagtacatgctggcggtggtg
A0A8B9IHS5_BOK-01       gaatactgaccccagccttcgctcccactggctcgtggctgctgtttgca
                            ***    *  * *   * *  **     *    ****  * * *  

A0A8B9EM33_BAK1-01      gccctggtgatggtggggcatttagtggtacgacg--cttcttcaggc--
A0A8B9IHS5_BOK-01       gcttt----------gggcacttcct--caaggcgatcttcttcgtgctg
                        **  *          ***** **  *   * * **  *******  **  

A0A8B9EM33_BAK1-01      ---cctga-------
A0A8B9IHS5_BOK-01       ctgcctgagagatga
                           *****       

© 1998-2023Legal notice