Dataset for CDS classical BH3-containing proteins of organism Tarsius syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U7T0R1_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7T0R1_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7T0R1_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7T0R1_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7T0R1_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7T0R1_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
                        **************************************************

A0A1U7T0R1_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7T0R1_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7T0R1_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7T0R1_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7T0R1_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7T0R1_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
                        **************************************************

A0A1U7T0R1_BCL2L11      cctccctacagacagagccgcaag--------------------------
A0A1U7T0R1_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7T0R1_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7T0R1_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7T0R1_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7T0R1_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
                        ************************                          

A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7T0R1_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7T0R1_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7T0R1_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7T0R1_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
                                                                          

A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7T0R1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7T0R1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7T0R1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7T0R1_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                                                                          

A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7T0R1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7T0R1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7T0R1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7T0R1_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7T0R1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7T0R1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7T0R1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7T0R1_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A1U7T0R1_BCL2L11      --------------------------------------------agtcca
A0A1U7T0R1_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatgg------
A0A1U7T0R1_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
A0A1U7T0R1_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
A0A1U7T0R1_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
A0A1U7T0R1_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaat--------
                                                                          

A0A1U7T0R1_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7T0R1_BCL2L11      -----------------------------------ttagagaaataga--
A0A1U7T0R1_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7T0R1_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7T0R1_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7T0R1_BCL2L11      --------------------------------------------------
                                                                          

A0A1U7T0R1_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7T0R1_BCL2L11      ----ggaagttgtcgtgtag------------------------------
A0A1U7T0R1_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7T0R1_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7T0R1_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7T0R1_BCL2L11      --------------------------------------------------
                                                                          

A0A1U7T0R1_BCL2L11      gagg-------------ctggcaaaaaacctagcatcctcctcttga---
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      gaggatgccctttccacctgattaa-------------------------
A0A1U7T0R1_BCL2L11      gagg---------ttagagaaatag-------------------------
A0A1U7T0R1_BCL2L11      gaggg-------cttatttgaataataaccaagcagccgaagatcaccca
A0A1U7T0R1_BCL2L11      --ggg-------cttatttgaataa-------------------------
                                                                          

A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      caaatggttctcttacgactgttacgttacattgtccgcctggtatggag
A0A1U7T0R1_BCL2L11      --------------------------------------------------
                                                                          

A0A1U7T0R1_BCL2L11      ----------
A0A1U7T0R1_BCL2L11      ----------
A0A1U7T0R1_BCL2L11      ----------
A0A1U7T0R1_BCL2L11      ----------
A0A1U7T0R1_BCL2L11      aatgtattga
A0A1U7T0R1_BCL2L11      ----------
                                  

© 1998-2020Legal notice