Dataset for CDS BMF of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1S3SNN2_BMF-01      atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctg
A0A1S3P5K4_BMF-01      atggacgatgaggaggatgatgtgtttgaaccaga---ctcccactgctg
A0A1S3P5K4_BMF-02      atggacgatgaggaggatgatgtgtttgaaccaga---ctcccactgctg
                       ***** **********************  *****   ************

A0A1S3SNN2_BMF-01      gcgcacagccttcagggaaataaagtacgaggacagaggcacccagacac
A0A1S3P5K4_BMF-01      gcgcacagccttcagggagataaagtacgaggacaggggaacccagacac
A0A1S3P5K4_BMF-02      gcgcacagccttcagggagataaagtacgaggacaggggaacccagacac
                       ****************** ***************** ** **********

A0A1S3SNN2_BMF-01      ccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcc
A0A1S3P5K4_BMF-01      ccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcc
A0A1S3P5K4_BMF-02      ccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcc
                       ********* **** **********  * *********** *********

A0A1S3SNN2_BMF-01      caggagcccagaccactcttctatggcaacgcaggctttcgattgcactt
A0A1S3P5K4_BMF-01      caggagcccagaccactcttctacggcaacgcaggctttcgattgcactt
A0A1S3P5K4_BMF-02      caggagcccagaccactcttctacggcaacgcaggctttcgattgcactt
                       *********************** **************************

A0A1S3SNN2_BMF-01      tccagcgcggtttgagcaggttggagaccaggggcctcaggagcagcatc
A0A1S3P5K4_BMF-01      cccagcgcagtttgagcgtgttggagaccaggggcc------------tc
A0A1S3P5K4_BMF-02      cccagcgcagtttgagcgtgttggagaccaggggcc------------tc
                        ******* ********  *****************            **

A0A1S3SNN2_BMF-01      agggggagcgagggaggatggaacggct---tcaa------cagcagcca
A0A1S3P5K4_BMF-01      tgggagagcgaggggggatggagaggctcaatcagcagccccagcagcca
A0A1S3P5K4_BMF-02      tgggagagcgaggggggatggagaggctcaatcagcagccccagcagcca
                        *** ********* *******  ****   ***       *********

A0A1S3SNN2_BMF-01      gcgcaaagcatggaggtctgcattggacagaaactccaactcatcggaga
A0A1S3P5K4_BMF-01      gcacgcagcatagagatctgcattggacagaaactccaactcatcggaga
A0A1S3P5K4_BMF-02      gcacgcagcatagagatctgcattggacagaaactccaactcatcggaga
                       ** *  ***** *** **********************************

A0A1S3SNN2_BMF-01      ccagttctaccaagaacaccttcaact-----------------------
A0A1S3P5K4_BMF-01      ccagttccaccaagaacatgttcaagtggtgagaatacccaacgtgactg
A0A1S3P5K4_BMF-02      ccagttccaccaagaacatgttcaagt-----------------------
                       ******* **********  ***** *                       

A0A1S3SNN2_BMF-01      --------gtatcaccgaaacc----------------------------
A0A1S3P5K4_BMF-01      actgcacagcacagctaaagcccactgaacaggcctactgtactcagagg
A0A1S3P5K4_BMF-02      --------gtatcaccgaaacc----------------------------
                               * *   *  ** **                            

A0A1S3SNN2_BMF-01      ---------aaaggaac----------atgaggcccatgtggtggcgcc-
A0A1S3P5K4_BMF-01      tctgctgagagagagactgagcagcagaagtggcttctttacgggcatcc
A0A1S3P5K4_BMF-02      ---------aaagaaac----------atgaggcccttgtggaggcgcc-
                                * **  **          * * ***   * *   ***  * 

A0A1S3SNN2_BMF-01      ----tggcctcagctctgttcaccctg-ctgtttgagcaggaggccattg
A0A1S3P5K4_BMF-01      attgtgttcacgtctcagtgtcccttgtttgttttggctag------tca
A0A1S3P5K4_BMF-02      ----tggcctcggctctgctcaccctg-ctgtttgagcaggaggccatcg
                           **  * *  *** *    ** **  *****  **  *      *  

A0A1S3SNN2_BMF-01      ctggaagggggagagcagggtg---------------------------g
A0A1S3P5K4_BMF-01      gtgagcatgcattagcccagtgttctgacctctcattctacccccccaag
A0A1S3P5K4_BMF-02      ctggaggggagagagcagggtg---------------------------g
                        **     *    ***   ***                           *

A0A1S3SNN2_BMF-01      aggtga
A0A1S3P5K4_BMF-01      acgtag
A0A1S3P5K4_BMF-02      aggtga
                       * **  

© 1998-2021Legal notice