Dataset for CDS classical BH3-containing proteins of organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4PGL2_PMAIP1-      atgcct-------------------------------acaaggaaggc--
A0A8C4L824_BCL2L11      atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcgg
A0A8C4L824_BCL2L11      atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcgg
A0A8C4L824_BCL2L11      atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcgg
A0A8C4KX59_BIK-01       atgtct------c---------------------------aagtaggacc
A0A8C4MCB2_BMF-01       atggag------tcgcctcagtgtgtagaggagctggaggatgatgtgtt
A0A8C4MCB2_BMF-02       atggag------tcgcctcagtgtgtagaggagctggaggatgatgtgtt
A0A8C4MYJ3_BAD-01       atgttc------cagatcccagagtttgagcagagtgagccagaagactc
A0A8C4MYJ3_BAD-02       atgttc------cagatcccagagtttgagcagagtgagccagaagactc
A0A8C4L4F7_BBC3-01      atggcc------c-------------------gagcacgccaggagggca
A0A8C4LTR5_HRK-01       atg-----------------------------------------------
                        ***                                               

A0A8C4PGL2_PMAIP1-      ------------------------------gcgtaagtctggg-------
A0A8C4L824_BCL2L11      acaattgcagcctgcggagaggcctcctcagctcaggcctggggccccca
A0A8C4L824_BCL2L11      acaattgcagcctgcggagaggcctcctcagctcaggcctggggccccca
A0A8C4L824_BCL2L11      acaattgcagcctgcggagaggcctcctcagctcaggcctggggccccca
A0A8C4KX59_BIK-01       cgtctccagggacctc-------------------tttctggatgccttc
A0A8C4MCB2_BMF-01       ccagccagaggatgggg------------------agccggggaccca--
A0A8C4MCB2_BMF-02       ccagccagaggatgggg------------------agccggggaccca--
A0A8C4MYJ3_BAD-01       cagccctgcagatagg-------------------ggcctgggcccca-g
A0A8C4MYJ3_BAD-02       cagccctgcagatagg-------------------ggcctgggcccca-g
A0A8C4L4F7_BBC3-01      gctccccggagccggtagagggcctggcccgcgacggcccgcgccccttc
A0A8C4LTR5_HRK-01       -----------------------------------tgcccgtgccccctg
                                                              * *         

A0A8C4PGL2_PMAIP1-      -------------------------------------cagcc--------
A0A8C4L824_BCL2L11      cctctctacagataga--------------------acagca--------
A0A8C4L824_BCL2L11      cctctctacagataga--------------------acagca--------
A0A8C4L824_BCL2L11      cctctctacagataga--------------------acagcaaggtaatc
A0A8C4KX59_BIK-01       ctgcacgagcgc---agcccggaagccctggaggttcctggcatga----
A0A8C4MCB2_BMF-01       --gcccaggagcttgctctctgctgacctg------tttgccccga----
A0A8C4MCB2_BMF-02       --gcccaggagcttgctctctgctgacctg------tttgccccga----
A0A8C4MYJ3_BAD-01       ccctacgggggact-ggccctcagacccgg------tcaggcacca----
A0A8C4MYJ3_BAD-02       ccctacgggggact-ggccctcagacccgg------tcaggcacca----
A0A8C4L4F7_BBC3-01      ccgctcagccgcctggtgccctcggccgtg------tcctgcggcctctg
A0A8C4LTR5_HRK-01       caccgcggacgc---ggcccccgggccgtg------t-------------
                                                                          

A0A8C4PGL2_PMAIP1-      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      ccggaggcgaaggggaccgctgcccccaaggcagccctctgggcccgctg
A0A8C4KX59_BIK-01       -----------------ccgagctcacagagtcctcccccgacagtgaca
A0A8C4MCB2_BMF-01       ---------------------gccagctggactgccccct--cagccatc
A0A8C4MCB2_BMF-02       ---------------------gccagctggactgccccct--cagccatc
A0A8C4MYJ3_BAD-01       ---------------------gcggacagccccaggcctc--ctggggga
A0A8C4MYJ3_BAD-02       ---------------------gcggacagccccaggcctc--ctggggga
A0A8C4L4F7_BBC3-01      cgagcccggcctgcccgccgcgcccgccgcgcccgccctg--ctgcccgc
A0A8C4LTR5_HRK-01       -------------------gtgcgtgcagcgcgggcc-------------
                                                                          

A0A8C4PGL2_PMAIP1-      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      gccccaccggccagccctggcccttttgctaccagatccccgtttttcat
A0A8C4KX59_BIK-01       accgtgactctgtggccatgcggc----------tggccttcatcgggga
A0A8C4MCB2_BMF-01       tgcggctcttccctctcacccactgctgtggccctggccttcgacccacc
A0A8C4MCB2_BMF-02       tgcggctcttccctctcacccactgctgtggccctggccttcgacccacc
A0A8C4MYJ3_BAD-01       agctggtcaccagcaggggcagcc------ggccagc-------agcagc
A0A8C4MYJ3_BAD-02       agctggtcaccagcaggggcagcc------ggccagc-------agcagc
A0A8C4L4F7_BBC3-01      tgcctacctctgcgccc--ccgcc------gccccgcccgccgtcaccgc
A0A8C4LTR5_HRK-01       -gcctgggtctgcgctcgtccgcc------gcgcagc------tcacggc
                                                                          

A0A8C4PGL2_PMAIP1-      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      ctttgtgagaagatcttccctgctgtctcgctcctccagtgggtatttct
A0A8C4KX59_BIK-01       cgagatgga-----------agtgagatggatgc----------------
A0A8C4MCB2_BMF-01       agccaggaa-----------gac---aaggccacccagaccctcagtcca
A0A8C4MCB2_BMF-02       agccaggaa-----------gac---aaggccacccagaccctcagtcca
A0A8C4MYJ3_BAD-01       caccatgga-----------ggcgctggggcggtggagacccggagtcgc
A0A8C4MYJ3_BAD-02       caccatgga-----------ggcgctggggcggtggagacccggagtcgc
A0A8C4L4F7_BBC3-01      cgccctggggggcccccgctggcctgggggcccccgc----agccgtccc
A0A8C4LTR5_HRK-01       cgccc---------------ggctcaaggcgctcggcgacgagctgcacc
                                                                          

A0A8C4PGL2_PMAIP1-      ----------------gagccc----------------------------
A0A8C4L824_BCL2L11      ----------agacaggagcccggcacccatgagttgtgacaaatcaaca
A0A8C4L824_BCL2L11      ----------agacaggagcccggcacccatgagttgtgacaaatcaaca
A0A8C4L824_BCL2L11      cttttgacacagacaggagcccggcacccatgagttgtgacaaatcaaca
A0A8C4KX59_BIK-01       --tgccccacatcgctgagctgcctgg-----------ggtggccgtgta
A0A8C4MCB2_BMF-01       gcctccccaagccagggtgtcatgctgccttgtggggtgac---cgagga
A0A8C4MCB2_BMF-02       gcctccccaagccagggtgtcatgctgccttgtggggtgac---cgagga
A0A8C4MYJ3_BAD-01       catagctcgtaccccgaagggaccgaggatgaagggatggaaggggagga
A0A8C4MYJ3_BAD-02       catagctcgtaccccgaagggaccgaggatgaagggatggaaggggagga
A0A8C4L4F7_BBC3-01      cgagccccgcgccccgacggtccacagccctcactcttgccggccgagca
A0A8C4LTR5_HRK-01       agcgcaccatgtggcggc--------------------gccg--cgcgcg
                                                                          

A0A8C4PGL2_PMAIP1-      --------------------------------------------------
A0A8C4L824_BCL2L11      caaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaat
A0A8C4L824_BCL2L11      caaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaat
A0A8C4L824_BCL2L11      caaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaat
A0A8C4KX59_BIK-01       cagcttggccttcacctacaaccagacaggcctgaggggtgtttttagaa
A0A8C4MCB2_BMF-01       accccagcgactcttttatggcaatgctggc--taccggctccct-----
A0A8C4MCB2_BMF-02       accccagcgactcttttatggcaatgctggc--taccggctccct-----
A0A8C4MYJ3_BAD-01       gcccggccccttc-----cggggccgctcgc--gctcggcgccccccaac
A0A8C4MYJ3_BAD-02       gcccggccccttc-----cggggccgctcgc--gctcggcgccccccaac
A0A8C4L4F7_BBC3-01      gcac--------c-----tggagtcgccggt--gcccagcgccccggggg
A0A8C4LTR5_HRK-01       gagc--------c-----ggagggcgccgga--gcccggcgcgct-----
                                                                          

A0A8C4PGL2_PMAIP1-      -------------------cacgcgagccccggcaga---gcttgaggct
A0A8C4L824_BCL2L11      ggcttccatgaggcagtcgcaggcg-gtccctgcagacatgcgcccggag
A0A8C4L824_BCL2L11      ggcttccatgaggcagtcgcaggcg-gtccctgcagacatgcgcccggag
A0A8C4L824_BCL2L11      ggcttccatgaggcagtcgcaggcg-gtccctgcagacatgcgcccggag
A0A8C4KX59_BIK-01       gtttcatggatggtctcactaa-------------------cctcaggga
A0A8C4MCB2_BMF-01       -------------ctccctgccagtttccctgcaggcttgccccttgg-t
A0A8C4MCB2_BMF-02       -------------ctccctgccagtttccctgcaggcttgccccttgg-t
A0A8C4MYJ3_BAD-01       ctctggg------ctgcactacgctacggccgcgagctc---cggaggat
A0A8C4MYJ3_BAD-02       ctctggg------ctgcactacgctacggccgcgagctc---cggaggat
A0A8C4L4F7_BBC3-01      ccctggagggcggccccacccaggcagccccgggagtccggggggaggag
A0A8C4LTR5_HRK-01       -------------ccccaccta----------------------------
                                                                          

A0A8C4PGL2_PMAIP1-      gagtgtgccattcaaa---ttag----------------------gag--
A0A8C4L824_BCL2L11      gtatggatcgctcaagagctgcg----------------------gag--
A0A8C4L824_BCL2L11      gtatggatcgctcaagagctgcg----------------------gag--
A0A8C4L824_BCL2L11      gtatggatcgctcaagagctgcg----------------------gag--
A0A8C4KX59_BIK-01       gaacataaggttctggagcttcctg--------------------accca
A0A8C4MCB2_BMF-01       gagcagcc--ccctgaagggcagtggcaacatc------------gagca
A0A8C4MCB2_BMF-02       gagcagcc--ccctgaagggcagtggcaacatc------------gagca
A0A8C4MYJ3_BAD-01       gagcgacgagttccagggctccttccaggt---------------gagcg
A0A8C4MYJ3_BAD-02       gagcgacgagttccagggctccttccaggcacttcctcgcccgaagagcg
A0A8C4L4F7_BBC3-01      gagcagtgggcccgggagatcg-----------------------gggcc
A0A8C4LTR5_HRK-01       ------ctggccctgg----ct-----------------------gtgcg
                                    *                                     

A0A8C4PGL2_PMAIP1-      ------------------------------------aattggagacaaac
A0A8C4L824_BCL2L11      ------------------------------------aattggagacgaat
A0A8C4L824_BCL2L11      ------------------------------------aattggagacgaat
A0A8C4L824_BCL2L11      ------------------------------------aattggagacgaat
A0A8C4KX59_BIK-01       cagggacagg--------------------------gtaagcctgagatt
A0A8C4MCB2_BMF-01       gaggtacag---------------------------attgcccgaaaact
A0A8C4MCB2_BMF-02       gaggtacag---------------------------attgcccgaaaact
A0A8C4MYJ3_BAD-01       ccggcgcggcg-cgcacgcccggacctgttctcccaggtcacctcccact
A0A8C4MYJ3_BAD-02       cgggcacggcgacgcagatgcgg---------------------------
A0A8C4L4F7_BBC3-01      cagctgcggcg-------------------------gatggcggacgacc
A0A8C4LTR5_HRK-01       cggccgc-gca-------------------------ggtggcg-------
                                                                          

A0A8C4PGL2_PMAIP1-      tgaatttc------------------------------------------
A0A8C4L824_BCL2L11      ttaatgcctcttaccca---------------------------------
A0A8C4L824_BCL2L11      ttaatgcctcttaccca---------------------------------
A0A8C4L824_BCL2L11      ttaatgcctcttaccca---------------------------------
A0A8C4KX59_BIK-01       tcatgaccttgactcaccttcctgcatgtgtagccctctggagccgtgga
A0A8C4MCB2_BMF-01       tcagtgcattgcagacc--------------agttccatcggcttcatat
A0A8C4MCB2_BMF-02       tcagtgcattgcagacc--------------agttccatcggcttcatat
A0A8C4MYJ3_BAD-01       gggctgtcccatc--cg--------------agtcccagtgcacgtcggg
A0A8C4MYJ3_BAD-02       ------------c--aa--------------agccccag-----------
A0A8C4L4F7_BBC3-01      tgaacgcgctgta--cg--------------agcggcggagacaagagga
A0A8C4LTR5_HRK-01       -----gcgctg---------------------------------------
                                                                          

A0A8C4PGL2_PMAIP1-      ----------cggcagaaac------------------------------
A0A8C4L824_BCL2L11      ----------cggagggtaa------------------------------
A0A8C4L824_BCL2L11      ----------cggagggtaa------------------------------
A0A8C4L824_BCL2L11      ----------cggagggtaa------------------------------
A0A8C4KX59_BIK-01       gcagctgccccgtagggcacagcctcgctggttgctgcagtccccaccaa
A0A8C4MCB2_BMF-01       gcagcaacaccagcagaaccgaaatc----gcgtg---------------
A0A8C4MCB2_BMF-02       gcagca-----agtaggcatgggagcttggggggg---------------
A0A8C4MYJ3_BAD-01       actgacgtctcaggacccctcccctcccacgggcctgtccccaagtccca
A0A8C4MYJ3_BAD-02       ----------ctggacgcgcgccatcc----------------agtcc--
A0A8C4L4F7_BBC3-01      gcagcagcgacaccgcccctcgccctggagggtcc--------tgtacaa
A0A8C4LTR5_HRK-01       --------------------------------------------------
                                                                          

A0A8C4PGL2_PMAIP1-      -----ttctgaatctcatag-----------------------ccaaact
A0A8C4L824_BCL2L11      -----tgctcttttccttaattctt-----------tttcttcccatacc
A0A8C4L824_BCL2L11      -----tgctcttttccttaattctt-----------tttcttcccatacc
A0A8C4L824_BCL2L11      -----tgctcttttccttaattctt-----------tttcttcccatacc
A0A8C4KX59_BIK-01       tccc-tattgtcttcttttg----------------cctg--------ct
A0A8C4MCB2_BMF-01       -----tggtgg--------------------cagaccctg--------ct
A0A8C4MCB2_BMF-02       -----tggtgagtcttctggggatggggggccggggcctgcctcaggact
A0A8C4MYJ3_BAD-01       gggcatgctgggatctgtagtt-------c-caggacccc--------tc
A0A8C4MYJ3_BAD-02       -----tggtgggatcggaacttggggagag-gaggctccg--------cc
A0A8C4L4F7_BBC3-01      tctcatcatgggact---------------------cctg--------cc
A0A8C4LTR5_HRK-01       --------------------------------------------------
                                                                          

A0A8C4PGL2_PMAIP1-      cttccgct---------------------caggaacc-------------
A0A8C4L824_BCL2L11      ctccccccaacaacatattaaaaaaaaaacagtgactagtaataactctg
A0A8C4L824_BCL2L11      ctccccccaacaacatattaaaaaaaaaacagtgactagtaataactctg
A0A8C4L824_BCL2L11      ctccccccaacaacatattaaaaaaaaaacagtgactagtaataactctg
A0A8C4KX59_BIK-01       tcacccattcctcctcctgcctgttccctgggcctttgg-----------
A0A8C4MCB2_BMF-01       ctttctccacaacctc-----------------gctttg----aacggag
A0A8C4MCB2_BMF-02       ccgtctgccaagcctcaaggataaggtcctggagttttggcctaatgctg
A0A8C4MYJ3_BAD-01       ccctcccaccggcctgtccccgagtcccagggcatgccg-----------
A0A8C4MYJ3_BAD-02       ccctccca------------------------------------------
A0A8C4L4F7_BBC3-01      cctacccaggggcc---------------gagcggcccc-----------
A0A8C4LTR5_HRK-01       --------gcggct---------------tggctgctcg-----------
                                                                          

A0A8C4PGL2_PMAIP1-      -----------------------------------tga
A0A8C4L824_BCL2L11      tgcttatgctggaaatgagaggtgttacctgtgtgtga
A0A8C4L824_BCL2L11      tgcttatgctggaaatgagaggtgttacctgtgtgtga
A0A8C4L824_BCL2L11      tgcttatgctggaaatgagaggtgttacctgtgtgtga
A0A8C4KX59_BIK-01       ---------------gtttgagatggctggcttactga
A0A8C4MCB2_BMF-01       acgaga---acaggaacggggcaggtccca---ggtga
A0A8C4MCB2_BMF-02       ttgtgattcccgtggactggatgggcccgactgcgtga
A0A8C4MYJ3_BAD-01       -----------ggatctgtagtccagaccgctccgtag
A0A8C4MYJ3_BAD-02       ----------------------------------gtga
A0A8C4L4F7_BBC3-01      -----------ggagatggagcccaa--------ctag
A0A8C4LTR5_HRK-01       -----------gcaggcggaacttg----------tag
                                                           *  

© 1998-2022Legal notice