Dataset for CDS BCL2L11 of organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4L824_BCL2L11      atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcgg
A0A8C4L824_BCL2L11      atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcgg
A0A8C4L824_BCL2L11      atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcgg
                        **************************************************

A0A8C4L824_BCL2L11      acaattgcagcctgcggagaggcctcctcagctcaggcctggggccccca
A0A8C4L824_BCL2L11      acaattgcagcctgcggagaggcctcctcagctcaggcctggggccccca
A0A8C4L824_BCL2L11      acaattgcagcctgcggagaggcctcctcagctcaggcctggggccccca
                        **************************************************

A0A8C4L824_BCL2L11      cctctctacagatagaacagca----------------------------
A0A8C4L824_BCL2L11      cctctctacagatagaacagca----------------------------
A0A8C4L824_BCL2L11      cctctctacagatagaacagcaaggtaatcccggaggcgaaggggaccgc
                        **********************                            

A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      tgcccccaaggcagccctctgggcccgctggccccaccggccagccctgg
                                                                          

A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      --------------------------------------------------
A0A8C4L824_BCL2L11      cccttttgctaccagatccccgtttttcatctttgtgagaagatcttccc
                                                                          

A0A8C4L824_BCL2L11      ----------------------------------------agacaggagc
A0A8C4L824_BCL2L11      ----------------------------------------agacaggagc
A0A8C4L824_BCL2L11      tgctgtctcgctcctccagtgggtatttctcttttgacacagacaggagc
                                                                **********

A0A8C4L824_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttg
A0A8C4L824_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttg
A0A8C4L824_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttg
                        **************************************************

A0A8C4L824_BCL2L11      ccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
A0A8C4L824_BCL2L11      ccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
A0A8C4L824_BCL2L11      ccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
                        **************************************************

A0A8C4L824_BCL2L11      aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctg
A0A8C4L824_BCL2L11      aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctg
A0A8C4L824_BCL2L11      aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctg
                        **************************************************

A0A8C4L824_BCL2L11      cggagaattggagacgaatttaatgcctcttacccacggagggtaatgct
A0A8C4L824_BCL2L11      cggagaattggagacgaatttaatgcctcttacccacggagggtaatgct
A0A8C4L824_BCL2L11      cggagaattggagacgaatttaatgcctcttacccacggagggtaatgct
                        **************************************************

A0A8C4L824_BCL2L11      cttttccttaattctttttcttcccataccctccccccaacaacatatta
A0A8C4L824_BCL2L11      cttttccttaattctttttcttcccataccctccccccaacaacatatta
A0A8C4L824_BCL2L11      cttttccttaattctttttcttcccataccctccccccaacaacatatta
                        **************************************************

A0A8C4L824_BCL2L11      aaaaaaaaacagtgactagtaataactctgtgcttatgctggaaatgaga
A0A8C4L824_BCL2L11      aaaaaaaaacagtgactagtaataactctgtgcttatgctggaaatgaga
A0A8C4L824_BCL2L11      aaaaaaaaacagtgactagtaataactctgtgcttatgctggaaatgaga
                        **************************************************

A0A8C4L824_BCL2L11      ggtgttacctgtgtgtga
A0A8C4L824_BCL2L11      ggtgttacctgtgtgtga
A0A8C4L824_BCL2L11      ggtgttacctgtgtgtga
                        ******************

© 1998-2022Legal notice