Dataset for CDS BAD of organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4MYJ3_BAD-01      atgttccagatcccagagtttgagcagagtgagccagaagactccagccc
A0A8C4MYJ3_BAD-02      atgttccagatcccagagtttgagcagagtgagccagaagactccagccc
                       **************************************************

A0A8C4MYJ3_BAD-01      tgcagataggggcctgggccccagccctacgggggactggccctcagacc
A0A8C4MYJ3_BAD-02      tgcagataggggcctgggccccagccctacgggggactggccctcagacc
                       **************************************************

A0A8C4MYJ3_BAD-01      cggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcac
A0A8C4MYJ3_BAD-02      cggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcac
                       **************************************************

A0A8C4MYJ3_BAD-01      cagcaggggcagccggccagcagcagccaccatggaggcgctggggcggt
A0A8C4MYJ3_BAD-02      cagcaggggcagccggccagcagcagccaccatggaggcgctggggcggt
                       **************************************************

A0A8C4MYJ3_BAD-01      ggagacccggagtcgccatagctcgtaccccgaagggaccgaggatgaag
A0A8C4MYJ3_BAD-02      ggagacccggagtcgccatagctcgtaccccgaagggaccgaggatgaag
                       **************************************************

A0A8C4MYJ3_BAD-01      ggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcg
A0A8C4MYJ3_BAD-02      ggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcg
                       **************************************************

A0A8C4MYJ3_BAD-01      ccccccaacctctgggctgcactacgctacggccgcgagctccggaggat
A0A8C4MYJ3_BAD-02      ccccccaacctctgggctgcactacgctacggccgcgagctccggaggat
                       **************************************************

A0A8C4MYJ3_BAD-01      gagcgacgagttccagggctccttccaggt---------------gagcg
A0A8C4MYJ3_BAD-02      gagcgacgagttccagggctccttccaggcacttcctcgcccgaagagcg
                       *****************************                *****

A0A8C4MYJ3_BAD-01      ccggcgcggcg-cgcacgcccggacctgttctcccaggtcacctcccact
A0A8C4MYJ3_BAD-02      cgggcacggcgacgcagatgcgg---------------------------
                       * *** ***** ****    ***                           

A0A8C4MYJ3_BAD-01      gggctgtcccatccgagtcccagtgcacgtcgggactgacgtctcaggac
A0A8C4MYJ3_BAD-02      ------------caaagccccag---------------------ctggac
                                   *  ** *****                     * ****

A0A8C4MYJ3_BAD-01      ccctcccctcccacgggcctgtccccaagtcccagggcatgctgggatct
A0A8C4MYJ3_BAD-02      gcgcgccatcc----------------agtcc-------tggtgggatcg
                        *   ** ***                *****       ** ******* 

A0A8C4MYJ3_BAD-01      gtagtt-------ccaggacccctcccctcccaccggcctgtccccgagt
A0A8C4MYJ3_BAD-02      gaacttggggagaggaggctccgccccctccca-----------------
                       * * **         ***  **  *********                 

A0A8C4MYJ3_BAD-01      cccagggcatgccgggatctgtagtccagaccgctccgtag
A0A8C4MYJ3_BAD-02      -------------------------------------gtga
                                                            **  

© 1998-2022Legal notice