Dataset for CDS classical BH3-containing proteins of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5QQC6_PMAIP1-      atg-----------------------------------------------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5Q1U2_BCL2L11      atg------gcaaagcaaccttccgatgtaagtt---ctgag--------
A0A2K5RN49_BMF-01       atg-----------gagccatctcagtgtg-------tggaggagctgga
A0A2K5RN49_BMF-02       atg-----------gagccatctcagtgtg-------tggaggagctgga
A0A2K5QXZ1_BIK-01       atgtctgaagaaagacccctctccattgacatcttgatggag--------
A0A2K5PDB1_BAD-02       atg-----------------ttccagatcc-------cagag--------
A0A2K5PDB1_BAD-01       atg-----------------ttccagatcc-------cagag--------
A0A2K5PDB1_BAD-03       atg-----------------ttccagatcc-------cagag--------
A0A2K5PIE7_HRK-01       atg-----------------tgcccgtgc---------------------
A0A2K5QNS7_BBC3-03      atgaaatgtggcgtggggtctgcctgggca-------t---g--------
A0A2K5QNS7_BBC3-01      atgaaatgtggcgtggggtctgcctgggca-------t---g--------
A0A2K5QNS7_BBC3-02      atgaaatgtggcgtggggtctgcctgggca-------t---g--------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5Q1U2_BCL2L11      -----------tgtgaccgagaaggtag--------------------ac
A0A2K5RN49_BMF-01       ggatgatgtgttccagccagaggatggggagccagggacccaacccggga
A0A2K5RN49_BMF-02       ggatgatgtgttccagccagaggatggggagccagggacccaacccggga
A0A2K5QXZ1_BIK-01       ----------accctcctgtgtgagcagttcatggatcccctgaccatgg
A0A2K5PDB1_BAD-02       ----------tttgagccgagtgagcag-----gaaggctccagc-----
A0A2K5PDB1_BAD-01       ----------tttgagccgagtgagcag-----gaaggctccagc-----
A0A2K5PDB1_BAD-03       ----------tttgagccgagtgagcag-----gaaggctccagc-----
A0A2K5PIE7_HRK-01       ----------cccctgcaccgcggccgc-----ggc-cccccggccgttt
A0A2K5QNS7_BBC3-03      ----------tccatgccaagtgcccag-----ggcttcttcctcggtgt
A0A2K5QNS7_BBC3-01      ----------tccatgccaagtgcccag-----ggcttcttcctcggtgt
A0A2K5QNS7_BBC3-02      ----------tccatgccaagtgcccag-----ggcttcttcctcggtgt

A0A2K5QQC6_PMAIP1-      --------cctgggaagaaggc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5Q1U2_BCL2L11      aattgcagcctgcggagagacc----------------------------
A0A2K5RN49_BMF-01       gcttgctctctgctgacctgtt----------------------------
A0A2K5RN49_BMF-02       gcttgctctctgctgacctgtt----------------------------
A0A2K5QXZ1_BIK-01       ag--gttgtcggtggtgggagt----------------------------
A0A2K5PDB1_BAD-02       --------tctgcagagagggg----------------------------
A0A2K5PDB1_BAD-01       --------tctgcagagagggg----------------------------
A0A2K5PDB1_BAD-03       --------tctgcagagagggg----------------------------
A0A2K5PIE7_HRK-01       gc--g---cctgcagcgcgggt----------------------------
A0A2K5QNS7_BBC3-03      gg--gttccttgccagatgtgt----------------------------
A0A2K5QNS7_BBC3-01      gg--gttccttgccagatgtgtggccccagggagcgccatggcccgcgca
A0A2K5QNS7_BBC3-02      gg--gttccttgccagatgtgt----------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cccgcgccccttcccgctcggccgcctggtgccctcggccgtgtcctgcg
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gcctctgcgagtccggcctgcccgccgcccctgccgcccccgccttgctg
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cccgctgcctacctctgcgcccccgccaccccacccgccgtcaccgccgc
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cctggggagcccccgctggcctgggggcccccgcagccgcccccgaggcc
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5Q1U2_BCL2L11      --------------------------------------------tcccca
A0A2K5RN49_BMF-01       --------------------------------------------tgccca
A0A2K5RN49_BMF-02       --------------------------------------------tgccca
A0A2K5QXZ1_BIK-01       -------------------------------------------gaccctg
A0A2K5PDB1_BAD-02       ----------------------------------------------cctg
A0A2K5PDB1_BAD-01       ----------------------------------------------cctg
A0A2K5PDB1_BAD-03       ----------------------------------------------cctg
A0A2K5PIE7_HRK-01       --------------------------------------------cgcctg
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctg
A0A2K5QNS7_BBC3-02      -----------ggtcctcagccctcgctctcgctggcggagcagcacctg

A0A2K5QQC6_PMAIP1-      gcgcaagagcgcgcaaccgagccccgcgccgg------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5Q1U2_BCL2L11      gctcagacctggggcccctacctccctacaga------------------
A0A2K5RN49_BMF-01       gagc-ctactgg----actgtcccctcagccg------------------
A0A2K5RN49_BMF-02       gagc-ctactgg----actgtcccctcagccg------------------
A0A2K5QXZ1_BIK-01       aagaggacctgg----acc----ctgtggagg------------------
A0A2K5PDB1_BAD-02       aacc-------------ccagcaccgcagggg------------------
A0A2K5PDB1_BAD-01       aacc-------------ccagcaccgcagggg------------------
A0A2K5PDB1_BAD-03       aacc-------------ccagcaccgcagggg------------------
A0A2K5PIE7_HRK-01       gggctgcgctcg----tccgccgc--------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gagtcgcccgtg----cccagcgccccgggggccctggcgggcggtccca
A0A2K5QNS7_BBC3-02      gagtcgcccgtg----cccagcgccccgggggccctggcgggcggtccca

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cccaggcggccctgggagtccgcggggaggaggagcagtgggcccgggag
A0A2K5QNS7_BBC3-02      cccaggcggccctgggagtccgcggggaggaggagcagtgggcccgggag

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       ---------------------------------------acccgttggaa
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      atcggggcccagctgcagcggatggcggacgacctcaacgcgcagtacga
A0A2K5QNS7_BBC3-02      atcggggcccagctgcagcggatggcggacgacctcaacgcgcagtacga

A0A2K5QQC6_PMAIP1-      ----------------ctccagc---------------------------
A0A2K5Q1U2_BCL2L11      -----------cagagccacaag---------------------------
A0A2K5Q1U2_BCL2L11      -----------cagagccacaag---------------------------
A0A2K5Q1U2_BCL2L11      -----------cagagccacaag---------------------------
A0A2K5Q1U2_BCL2L11      -----------cagagccacaaggtaatcccgaaggcaatcacggaggtg
A0A2K5Q1U2_BCL2L11      -----------cagagccacaaggtaatcccgaaggcaatcacggaggtg
A0A2K5Q1U2_BCL2L11      -----------cagagccaca-----------------------------
A0A2K5Q1U2_BCL2L11      -----------cagagccacaaggtaatcccgaaggcaatcacggaggtg
A0A2K5Q1U2_BCL2L11      -----------cagagccacaaggtaatcccgaaggcaatcacggaggtg
A0A2K5Q1U2_BCL2L11      -----------cagagccacaaggtaatcccgaaggcaatcacggaggtg
A0A2K5Q1U2_BCL2L11      -----------cagagccacaaggtaatcccgaaggcaatcacggaggtg
A0A2K5RN49_BMF-01       ---------------gcttcagc---------------------------
A0A2K5RN49_BMF-02       ---------------gcttcagc---------------------------
A0A2K5QXZ1_BIK-01       tgcatggagaacagtgacgcact---------------------------
A0A2K5PDB1_BAD-02       ------------------acagc---------------------------
A0A2K5PDB1_BAD-01       ------------------acagc---------------------------
A0A2K5PDB1_BAD-03       ------------------acagc---------------------------
A0A2K5PIE7_HRK-01       ------------------gcagc---------------------------
A0A2K5QNS7_BBC3-03      ------gagacaagaggagcagc---------------------------
A0A2K5QNS7_BBC3-01      gcggcggagacaagaggagcagc---------------------------
A0A2K5QNS7_BBC3-02      gcggcggagacaagaggagcagc---------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      aaggggacagctgcccccacggcagccctcagggcccgctggccccaccg
A0A2K5Q1U2_BCL2L11      aaggggacagctgcccccacggcagccctcagggcccgctggccccaccg
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      aaggggacagctgcccccacggcagccctcagggcccgctggccccaccg
A0A2K5Q1U2_BCL2L11      aaggggacagctgcccccacggcagccctcagggcccgctggccccaccg
A0A2K5Q1U2_BCL2L11      aaggggacagctgcccccacggcagccctcagggcccgctggccccaccg
A0A2K5Q1U2_BCL2L11      aaggggacagctgcccccacggcagccctcagggcccgctggccccaccg
A0A2K5RN49_BMF-01       ------------------------tcttc----cctctcacccactgctg
A0A2K5RN49_BMF-02       ------------------------tcttc----cctctcacccactgctg
A0A2K5QXZ1_BIK-01       ------------------------ggccctgcagctggcctgcatcgcgg
A0A2K5PDB1_BAD-02       ------------------------cccccaggctctggcaagcatcgacg
A0A2K5PDB1_BAD-01       ------------------------cccccaggctctggcaagcatcgacg
A0A2K5PDB1_BAD-03       ------------------------cccccaggctctggcaagcatcgacg
A0A2K5PIE7_HRK-01       ------------------------t-----------------caccgccg
A0A2K5QNS7_BBC3-03      ------------------------cgc-------------agcaccgccc
A0A2K5QNS7_BBC3-01      ------------------------cgc-------------agcaccgccc
A0A2K5QNS7_BBC3-02      ------------------------cgc-------------agcaccgccc

A0A2K5QQC6_PMAIP1-      --------------agaccttgaagtcgagtgtgctactcaac-------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gcc-----------agccctggcccttttgctaccagatccccgcttttc
A0A2K5Q1U2_BCL2L11      gcc-----------agccctggcccttttgctaccagatccccgcttttc
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gcc-----------agccctggcccttttgctaccagatccccgcttttc
A0A2K5Q1U2_BCL2L11      gcc-----------agccctggcccttttgctaccagatccccgcttttc
A0A2K5Q1U2_BCL2L11      gcc-----------agccctggcccttttgctaccagatccccgcttttc
A0A2K5Q1U2_BCL2L11      gcc-----------agccctggcccttttgctaccagatccccgcttttc
A0A2K5RN49_BMF-01       t-------------ggccctggccttc----gacccaccagcc-aggaag
A0A2K5RN49_BMF-02       t-------------ggccctggccttc----gacccaccagcc-aggaag
A0A2K5QXZ1_BIK-01       accagatggatgtgagccttagggccc-----ggaagctggcccagctct
A0A2K5PDB1_BAD-02       cca-----------ggccccaggcctcccgggggacgccagtc-------
A0A2K5PDB1_BAD-01       cca-----------ggccccaggcctcccgggggacgccagtc-------
A0A2K5PDB1_BAD-03       cca-----------ggccccaggcctcccgggggacgccagtc-------
A0A2K5PIE7_HRK-01       ccc-----------ggctcaaggcgctcggcgacgagctg--c-------
A0A2K5QNS7_BBC3-03      ctc-----------gccctggagggtc----------ctg--t-------
A0A2K5QNS7_BBC3-01      ctc-----------gccctggagggtc----------ctg--t-------
A0A2K5QNS7_BBC3-02      ctc-----------gccctggagggtc----------ctg--t-------

A0A2K5QQC6_PMAIP1-      -------------------------------------tcaggaga-----
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      atctttgtgagaagatcctccgtgctgtctcgatcctccagtggg-----
A0A2K5Q1U2_BCL2L11      atctttgtgagaagatcctccgtgctgtctcgatcctccagtggg-----
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      atctttgtgagaagatcctccgtgctgtctcgatcctccagtggg-----
A0A2K5Q1U2_BCL2L11      atctttgtgagaagatcctccgtgctgtctcgatcctccagtggg-----
A0A2K5Q1U2_BCL2L11      atctttgtgagaagatcctccgtgctgtctcgatcctccagtggg-----
A0A2K5Q1U2_BCL2L11      atctttgtgagaagatcctccgtgctgtctcgatcctccagtggg-----
A0A2K5RN49_BMF-01       acaaggctacccagaccctcagcccagcctcccccagccaaggtg-----
A0A2K5RN49_BMF-02       acaaggctacccagaccctcagcccagcctcccccagccaaggtg-----
A0A2K5QXZ1_BIK-01       acgaggtggccatgtacagcccgggtctcgctgtca-cccttgac-----
A0A2K5PDB1_BAD-02       accag-----cagggacagccaaccagcagcagcca-ccatggagggact
A0A2K5PDB1_BAD-01       accag-----cagggacagccaaccagcagcagcca-cca----------
A0A2K5PDB1_BAD-03       accag-----cagggacagccaaccagcagcagcca-ccatggagagaat
A0A2K5PIE7_HRK-01       accag-----c----------------------gca-ccatgtgg-----
A0A2K5QNS7_BBC3-03      acaat-----c----------------------tca-tcatggga-----
A0A2K5QNS7_BBC3-01      acaat-----c----------------------tca-tcatggga-----
A0A2K5QNS7_BBC3-02      acaat-----c----------------------tca-tcatggga-----

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       tcc-----------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       cccagtgcaaggatgctctcgaaaacatcagcagggatgtcttccccagc
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ------------------------------------------tatttctc
A0A2K5Q1U2_BCL2L11      ------------------------------------------tatttctc
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ------------------------------------------tatttctc
A0A2K5Q1U2_BCL2L11      ------------------------------------------tatttctc
A0A2K5Q1U2_BCL2L11      ------------------------------------------tatttctc
A0A2K5Q1U2_BCL2L11      ------------------------------------------tatttctc
A0A2K5RN49_BMF-01       --------------------------------------tcatgctgcctt
A0A2K5RN49_BMF-02       --------------------------------------tcatgctgcctt
A0A2K5QXZ1_BIK-01       ---------------------------cagaccgacatcagggatgttct
A0A2K5PDB1_BAD-02       ------------------tcgcccgaagagcgcgggcacagcaacgca--
A0A2K5PDB1_BAD-01       --------------------------------------tggaggcgct--
A0A2K5PDB1_BAD-03       cactgactcagaagcccaacacacagagaatgtaaagctggaggcgct--
A0A2K5PIE7_HRK-01       -----------------------------------------cggcgccgc
A0A2K5QNS7_BBC3-03      --------------------------------------ctcctgcccttt
A0A2K5QNS7_BBC3-01      --------------------------------------ctcctgcccttt
A0A2K5QNS7_BBC3-02      --------------------------------------ctcctgcccttt

A0A2K5QQC6_PMAIP1-      tttggagacaaactgaatttccg---------------------------
A0A2K5Q1U2_BCL2L11      -----------acaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      -----------acaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ttttgacacagacaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      ttttgacacagacaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      ---------agacaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      ttttgacacagacaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      ttttgacacagacaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      ttttgacacagacaggagcccag---------------------------
A0A2K5Q1U2_BCL2L11      ttttgacacagacaggagcccag---------------------------
A0A2K5RN49_BMF-01       gtggggtgactgaggaaccccagcgactcttttatggcaatgctggctac
A0A2K5RN49_BMF-02       gtggggtgactgaggaaccccagcgactcttttatg--------------
A0A2K5QXZ1_BIK-01       cggcggta-ttgtggacattt-----------------------------
A0A2K5PDB1_BAD-02       ----gatg-cggcaaagcgccagctggacgcgagtc--------------
A0A2K5PDB1_BAD-01       ----gggg-ctgtggagacccgg--agtcgccacag--------------
A0A2K5PDB1_BAD-03       ----gggg-ctgtggagacccgg--agtcgccacag--------------
A0A2K5PIE7_HRK-01       gcgcggag-ccggagggcgcc-----------------------------
A0A2K5QNS7_BBC3-03      cccagggg-ccacagagcccccg---------------------------
A0A2K5QNS7_BBC3-01      cccagggg-ccacagagcccccg---------------------------
A0A2K5QNS7_BBC3-02      cccagggg-ccacagagcccccg---------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       cggcttcctctccctgccagtttcccggcagtcttgccccttggggaaca
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       -----------------------------------------------atc
A0A2K5PDB1_BAD-01       -----------------------------------------------atc
A0A2K5PDB1_BAD-03       -----------------------------------------------atc
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5Q1U2_BCL2L11      ---cacccatgagttgtgaca-----------------------------
A0A2K5RN49_BMF-01       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       -----tcgctaacttccaggaggacgtag------------tga------
A0A2K5PDB1_BAD-02       cagtcctggtgggat---------cggaacttgggcaggggagg------
A0A2K5PDB1_BAD-01       gtaccccgcagggacggaggaggacgaag---ggatggaggagg------
A0A2K5PDB1_BAD-03       gtaccccgcagggacggaggaggacgaag---ggatggaggagg------
A0A2K5PIE7_HRK-01       ------------------------------------------gg------
A0A2K5QNS7_BBC3-03      --------------------------------------agatgg------
A0A2K5QNS7_BBC3-01      --------------------------------------agatgg------
A0A2K5QNS7_BBC3-02      --------------------------------------agatgg------

A0A2K5QQC6_PMAIP1-      ----------------------------------gcagaaacttctgaat
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5Q1U2_BCL2L11      ---------------------aatcaacacaaaccccaagtcctacttgc
A0A2K5RN49_BMF-01       agcttcagtgcattgcagaccagttccaccagcttcatgtgcagcaacac
A0A2K5RN49_BMF-02       -----------------------------------------------cac
A0A2K5QXZ1_BIK-01       ---------------------ggctctggagatccctgagctccgggtcc
A0A2K5PDB1_BAD-02       ---------------------a-tccgctccctcccagtgacctt--cgc
A0A2K5PDB1_BAD-01       ---------------------agcccagcacctttcggggccgttcgcgc
A0A2K5PDB1_BAD-03       ---------------------agcccagcacctttcggggccgttcgcgc
A0A2K5PIE7_HRK-01       ---------------------cgcccagcgcgctccccacctactggccc
A0A2K5QNS7_BBC3-03      ---------------------agcccaattaggtgcctgcacctgcccgg
A0A2K5QNS7_BBC3-01      ---------------------agcccaattaggtgcctgcacctgcccgg
A0A2K5QNS7_BBC3-02      ---------------------agcccaattag------------------

A0A2K5QQC6_PMAIP1-      ctgatatcca----------------------------------------
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggat--------gaggccact
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatgggt--------gatatttca
A0A2K5Q1U2_BCL2L11      -------------------------------cttccatgaggcaatctca
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggtt-----------------
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaat---------------------
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggcttccatgaggcaatctca
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggcttccatgaggcaatctca
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggcttccatgaggcaatctca
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggcttccatgaggcaatctca
A0A2K5Q1U2_BCL2L11      caggccttcaaccactatctcagtgcaatggct-----------------
A0A2K5RN49_BMF-01       cagcagaaccgaaatcgcgtgtggtggcaggtc----------------c
A0A2K5RN49_BMF-02       cagcagaaccgaaatcgcgtgtggtggcaggtc----------------c
A0A2K5QXZ1_BIK-01       tgggtgtcccgcaaacaggcagtgctgctggca----------------t
A0A2K5PDB1_BAD-02       tccacatcccaaaactcc------accc----------------------
A0A2K5PDB1_BAD-01       tcggcaccccccaacctctgggcagcac----------------------
A0A2K5PDB1_BAD-03       tcggcaccccccaacctctgggcagcac----------------------
A0A2K5PIE7_HRK-01       tggctgtgcgcggc-cgcgcaggtg-gc----------------------
A0A2K5QNS7_BBC3-03      tggacgtcagggactcggggggcag-gc----------------------
A0A2K5QNS7_BBC3-01      tggacgtcagggactcggggggcag-gc----------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      ----aactcttctgctcaggaacatga-----------------------
A0A2K5Q1U2_BCL2L11      ggatcctcccttggaattgcccttcgtagggaggttcagtggccagttga
A0A2K5Q1U2_BCL2L11      t----------------------------tgtggtttagtcaag------
A0A2K5Q1U2_BCL2L11      ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
A0A2K5Q1U2_BCL2L11      ------------------------agagaaataga------ggaagttgt
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
A0A2K5Q1U2_BCL2L11      ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
A0A2K5Q1U2_BCL2L11      ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
A0A2K5Q1U2_BCL2L11      ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
A0A2K5Q1U2_BCL2L11      gactgggcctag--------------------------------------
A0A2K5RN49_BMF-01       tcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggg
A0A2K5RN49_BMF-02       tcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggg
A0A2K5QXZ1_BIK-01       tcctggcgctgctgctggcgacgttcagcgggggtctg------------
A0A2K5PDB1_BAD-02       ----gctcttatcgccctgagtggccatcttggatatgggc---------
A0A2K5PDB1_BAD-01       ----agcgctatggccgcgagc-----tccggaggatgagtgacgagttc
A0A2K5PDB1_BAD-03       ----agcgctatggccgcgagc-----tccggaggatga-----------
A0A2K5PIE7_HRK-01       ----ggcgctggcggcctggctgctcggcaggc-----------------
A0A2K5QNS7_BBC3-03      ----ccctcccacctcctgacaccctggccagcgcgggg-----------
A0A2K5QNS7_BBC3-01      ----ccctcccacctcctgacaccctggccagcgcgggg-----------
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gtggttagcaaaatccagctga----------------------------
A0A2K5Q1U2_BCL2L11      ---gtacagaacaactccatcacaagtatttctcatga------------
A0A2K5Q1U2_BCL2L11      ggcgtatcggagacgagtttaacgcttattatccaaggaggctg------
A0A2K5Q1U2_BCL2L11      cgtgtag-------------------------------------------
A0A2K5Q1U2_BCL2L11      ---------------------------------------gggtattttt-
A0A2K5Q1U2_BCL2L11      ggcgtatcggagacgagtttaacgcttattatccaaggagggtattttt-
A0A2K5Q1U2_BCL2L11      ggcgtatcggagacgagtttaacgcttattatccaaggagggtattttt-
A0A2K5Q1U2_BCL2L11      ggcgtatcggagacgagtttaacgcttattatccaaggaggatatctctt
A0A2K5Q1U2_BCL2L11      ggcgtatcggagacgagtttaacgcttattatccaaggaggtta------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       gcag----------------------------------------------
A0A2K5RN49_BMF-02       gcag----------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------ggaagtgcttcctgcagggagggctgacccag----
A0A2K5PDB1_BAD-01       gtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcaac
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ------gcaaaa--------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ------gaataa--------------------------------------
A0A2K5Q1U2_BCL2L11      ------gaataattaccaagcagccgaagaccacccacacatggttatct
A0A2K5Q1U2_BCL2L11      ------gaataattaccaagcagccgaagaccacccacacatggttatct
A0A2K5Q1U2_BCL2L11      ccatctgattga--------------------------------------
A0A2K5Q1U2_BCL2L11      ------gagaaatag-----------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5PDB1_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-01       gcagatgcggcaaagcgccagctggacgcgagtcatccagtcctggtggg
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QQC6_PMAIP1-      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      ---------ctcttggcatcctccacctga-----------------
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      tacgactgttacgttacattgtccgcctggtgtggagaatgcattga
A0A2K5Q1U2_BCL2L11      tacgactgttacgttacattgtccgcctggtgtggagaatgcattga
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5Q1U2_BCL2L11      -----------------------------------------------
A0A2K5RN49_BMF-01       ------------------------------------gcctgaggtga
A0A2K5RN49_BMF-02       ------------------------------------gcctgag----
A0A2K5QXZ1_BIK-01       -----------------------------cacctgctgctcaagtga
A0A2K5PDB1_BAD-02       --------------------------attcccttccggtgcgtgtga
A0A2K5PDB1_BAD-01       atcggaacttgggcaggggaggatccgctccctcccagtga------
A0A2K5PDB1_BAD-03       -----------------------------------------------
A0A2K5PIE7_HRK-01       ------------------------------------ggaacttgtag
A0A2K5QNS7_BBC3-03      --------------------------gactttctctgcaccatgtag
A0A2K5QNS7_BBC3-01      --------------------------gactttctctgcaccatgtag
A0A2K5QNS7_BBC3-02      -----------------------------------------------

© 1998-2021Legal notice