Dataset for CDS classical BH3-containing proteins of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5QXZ1_BIK-01       atgtctgaagaaagacccc-------tctccattgacatcttgatggaga
A0A2K5QQC6_PMAIP1-      atgcc----------------------------------tgggaagaagg
A0A2K5Q1Y0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1Y0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5RN49_BMF-02       atggagcc-----atctcagtgtgtg----gag-gag--ctggaggatga
A0A2K5RN49_BMF-01       atggagcc-----atctcagtgtgtg----gag-gag--ctggaggatga
A0A2K5PDB1_BAD-01       atgttccag----atcccagagtttgagccgagtgag--caggaag----
A0A2K5PDB1_BAD-03       atgttccag----atcccagagtttgagccgagtgag--caggaag----
A0A2K5PIE7_HRK-01       atg-----------------------------------------------
A0A2K5QNS7_BBC3-02      atgaaatgt----ggcgtggggtctgcctgggc-----------------
                        ***                                               

A0A2K5QXZ1_BIK-01       ccctcctgtgtgagcagttcatggatc----ccctgaccatggaggttgt
A0A2K5QQC6_PMAIP1-      cgcgc---------------aagagcgcgcaaccgagccccgcg------
A0A2K5Q1Y0_BCL2L11      acaattgcagcc-tgcggagagacctccccagctcagacctgggg-----
A0A2K5Q1Y0_BCL2L11      acaattgcagcc-tgcggagagacctccccagctcagacctgggg-----
A0A2K5RN49_BMF-02       tgtgttccagccagaggatggggagccagggacccaacccgggagcttgc
A0A2K5RN49_BMF-01       tgtgttccagccagaggatggggagccagggacccaacccgggagcttgc
A0A2K5PDB1_BAD-01       ---gctccagctctgcagagaggggcctgaaccccagcaccgcag-----
A0A2K5PDB1_BAD-03       ---gctccagctctgcagagaggggcctgaaccccagcaccgcag-----
A0A2K5PIE7_HRK-01       --tgcccgtgcc------------ccctgcaccgcggccgcggc------
A0A2K5QNS7_BBC3-02      -atgtccatgcca-------agtgcccagggcttcttcctcggtgtgggt
                                                                 *        

A0A2K5QXZ1_BIK-01       cggtggt-----------------------gggagtgaccctgaagagga
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------cccc--------
A0A2K5Q1Y0_BCL2L11      --------------------------------------cccc--------
A0A2K5RN49_BMF-02       tctctgctgacctgtttgcccagagcctactggactgtcccctcagccgg
A0A2K5RN49_BMF-01       tctctgctgacctgtttgcccagagcctactggactgtcccctcagccgg
A0A2K5PDB1_BAD-01       ------------------------------gggacagccccc----cagg
A0A2K5PDB1_BAD-03       ------------------------------gggacagccccc----cagg
A0A2K5PIE7_HRK-01       -------------------------------------ccccc------gg
A0A2K5QNS7_BBC3-02      tccttgccaga-------------------tgtgtggtcctc------ag
                                                                          

A0A2K5QXZ1_BIK-01       c------------ctggaccctgtgg---aggacccgttggaatgca---
A0A2K5QQC6_PMAIP1-      -------------ccggctccagcag--------accttgaagtc-----
A0A2K5Q1Y0_BCL2L11      -------------tacctccctacagacagagccacaaggtaatcccgaa
A0A2K5Q1Y0_BCL2L11      -------------tacctccctacagacagagccacaaggtaatcccgaa
A0A2K5RN49_BMF-02       cttcagctcttccctctcacccactgctgtg---gccctggccttc---g
A0A2K5RN49_BMF-01       cttcagctcttccctctcacccactgctgtg---gccctggccttc---g
A0A2K5PDB1_BAD-01       ctctgg-------caagcatcgac-gccagg---ccccaggcctcccggg
A0A2K5PDB1_BAD-03       ctctgg-------caagcatcgac-gccagg---ccccaggcctcccggg
A0A2K5PIE7_HRK-01       c---cg-------tttgcgcctgcagcgcgggtcgcctggggctgcgctc
A0A2K5QNS7_BBC3-02      ccctcg-------ctctcgctggcggagcag--cacctggagtcgcccgt
                                                 *         *   *          

A0A2K5QXZ1_BIK-01       --------------------tggagaacagtgacgcactggccctgcagc
A0A2K5QQC6_PMAIP1-      -------------------------gagtgtgctac-tcaa---------
A0A2K5Q1Y0_BCL2L11      ggcaatcacggagg------tgaaggggacagctgc-cc----ccacggc
A0A2K5Q1Y0_BCL2L11      ggcaatcacggagg------tgaaggggacagctgc-cc----ccacggc
A0A2K5RN49_BMF-02       acccaccagcca---------ggaagacaaggctac-ccagaccctcagc
A0A2K5RN49_BMF-01       acccaccagcca---------ggaagacaaggctac-ccagaccctcagc
A0A2K5PDB1_BAD-01       ggacgccagtcac-------cagcagggacagccaa-ccag--cagcagc
A0A2K5PDB1_BAD-03       ggacgccagtcac-------cagcagggacagccaa-ccag--cagcagc
A0A2K5PIE7_HRK-01       gtccgccgcgcag------------------ctcac-c----------gc
A0A2K5QNS7_BBC3-02      gcccagcgccccgggggccctggcgggcggtcccac-ccag-------gc
                                                                          

A0A2K5QXZ1_BIK-01       tggcctgca-----------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      agccctcagggcccgct---------------------------------
A0A2K5Q1Y0_BCL2L11      agccctcagggcccgct---------------------------------
A0A2K5RN49_BMF-02       --cca---------------------------------------------
A0A2K5RN49_BMF-01       --cca---------------------------------------------
A0A2K5PDB1_BAD-01       cacca---------------------------------------------
A0A2K5PDB1_BAD-03       caccatggagagaatcccagtgcaaggatgctctcgaaaacatcagcagg
A0A2K5PIE7_HRK-01       cgccc---------------------------------------------
A0A2K5QNS7_BBC3-02      ggccctgggagtccgcgggg------------------------------
                                                                          

A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      ---ggccccaccggccag--------------------------------
A0A2K5Q1Y0_BCL2L11      ---ggccccaccggccag--------------------------------
A0A2K5RN49_BMF-02       ---gcctcccccagccaaggtgtcatgctgcct-----------------
A0A2K5RN49_BMF-01       ---gcctcccccagccaaggtgtcatgctgcct-----------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       gatgtcttccccagccactgactcagaagcccaacacacagagaatgtaa
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5QXZ1_BIK-01       ---tcgcggaccagatggatgtgagccttagggcccg-------------
A0A2K5QQC6_PMAIP1-      -----------------ctcaggagatttggagacaa-------------
A0A2K5Q1Y0_BCL2L11      ---ccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K5Q1Y0_BCL2L11      ---ccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K5RN49_BMF-02       ---tgtggg----gtgactgaggaaccccagcgactcttttatg------
A0A2K5RN49_BMF-01       ---tgtggg----gtgactgaggaaccccagcgactcttttatggcaatg
A0A2K5PDB1_BAD-01       ---tggaggcgctggggctgtggagacccggagtcgc-------------
A0A2K5PDB1_BAD-03       agctggaggcgctggggctgtggagacccggagtcgc-------------
A0A2K5PIE7_HRK-01       ---------------ggctcaaggcgctcggcgacga-------------
A0A2K5QNS7_BBC3-02      ---aggaggagcagtgggcccgggagatcggggccca-------------
                                                      *                   

A0A2K5QXZ1_BIK-01       -------------------------------gaagctggcccagctctac
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      gat-------------------------cctccgtgctgtctcgatcctc
A0A2K5Q1Y0_BCL2L11      gat-------------------------cctccgtgctgtctcgatcctc
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       ctggctaccggcttcctctccctgccagtttcccggcagtcttgcccctt
A0A2K5PDB1_BAD-01       ---------------------------------cacagatcgtaccccgc
A0A2K5PDB1_BAD-03       ---------------------------------cacagatcgtaccccgc
A0A2K5PIE7_HRK-01       ----------------------------gctgcacc----agcgcaccat
A0A2K5QNS7_BBC3-02      ----------------------------gctgcagcggatggcggacgac
                                                                          

A0A2K5QXZ1_BIK-01       gaggtggccatgtac--------------------------agcccgggt
A0A2K5QQC6_PMAIP1-      --------actgaatttccggcaga-------------------------
A0A2K5Q1Y0_BCL2L11      cagtgggtatttctcttttgacacagacagga----------gcccag--
A0A2K5Q1Y0_BCL2L11      cagtgggtatttctcttttgacacagacagga----------gcccag--
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       ggggaacagccccccgaagggcagtggcaacatcgagcagaggtacagat
A0A2K5PDB1_BAD-01       aggga---------cggaggaggacgaagggatggaggaggagcccag--
A0A2K5PDB1_BAD-03       aggga---------cggaggaggacgaagggatggaggaggagcccag--
A0A2K5PIE7_HRK-01       gtggcggcgccgcgc-----gcggagccggag-ggcgccggcgcccagcg
A0A2K5QNS7_BBC3-02      ctcaacgcgcagtacgagcggcggagacaaga-ggagcagccgc----ag
                                                                          

A0A2K5QXZ1_BIK-01       ctcgctgt------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       tgcccgaaagcttcagtgcattgcagaccagttccaccagcttcatgtgc
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       cgctccccacctact-----------------------------------
A0A2K5QNS7_BBC3-02      caccgccc-----ct-----------------------------------
                                                                          

A0A2K5QXZ1_BIK-01       -----cacccttgaccagaccgacatcag-----ggatgttctcggcggt
A0A2K5QQC6_PMAIP1-      -----aacttctgaa-----------------------------------
A0A2K5Q1Y0_BCL2L11      -----cacccatgagttgtgacaaatcaacacaaaccccaagtcctactt
A0A2K5Q1Y0_BCL2L11      -----cacccatgagttgtgacaaatcaacacaaaccccaagtcctactt
A0A2K5RN49_BMF-02       -----cacc-agcag-------------------aaccgaaatcgcgtgt
A0A2K5RN49_BMF-01       agcaacacc-agcag-------------------aaccgaaatcgcgtgt
A0A2K5PDB1_BAD-01       -----cacctttcgg-------------------ggccg--ttcgcgctc
A0A2K5PDB1_BAD-03       -----cacctttcgg-------------------ggccg--ttcgcgctc
A0A2K5PIE7_HRK-01       -----ggccctggct-------------------gtgcgcggccgcgcag
A0A2K5QNS7_BBC3-02      -----cgccctggag-------------------ggtcctgtacaatctc
                               *                                          

A0A2K5QXZ1_BIK-01       attgtggacattttcgctaacttccaggaggacgtagtg-----------
A0A2K5QQC6_PMAIP1-      ----------------tctgatatccaaactcttctgct-----------
A0A2K5Q1Y0_BCL2L11      gccaggc--cttcaaccactatctcagtgcaa--tggtt-----------
A0A2K5Q1Y0_BCL2L11      gccaggc--cttcaaccactatctcagtgcaa--tggcttccatgaggca
A0A2K5RN49_BMF-02       g----gtggcaggtcctcctcttcctgcacaacctggct-----------
A0A2K5RN49_BMF-01       g----gtggcaggtcctcctcttcctgcacaacctggct-----------
A0A2K5PDB1_BAD-01       g----gc-----accccccaacctctgggcagcacagcg-----------
A0A2K5PDB1_BAD-03       g----gc-----accccccaacctctgggcagcacagcg-----------
A0A2K5PIE7_HRK-01       gtggcggcgctggcggcct--------ggctgctcggc------------
A0A2K5QNS7_BBC3-02      atcatgggactcctgccctttcccaggggccacagagcc-----------
                                                            *             

A0A2K5QXZ1_BIK-01       -----------------------aggctctggagatccctgagctccggg
A0A2K5QQC6_PMAIP1-      ---------------------------------------------cagga
A0A2K5Q1Y0_BCL2L11      ------------------------------agagaaataga------gga
A0A2K5Q1Y0_BCL2L11      atctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaag
A0A2K5RN49_BMF-02       ----------------------------ttgaatggagaagagaacagga
A0A2K5RN49_BMF-01       ----------------------------ttgaatggagaagagaacagga
A0A2K5PDB1_BAD-01       ----------------------------ct--atggccgcgagctccgga
A0A2K5PDB1_BAD-03       ----------------------------ct--atggccgcgagctccgga
A0A2K5PIE7_HRK-01       --------------------------------agg-----------cgga
A0A2K5QNS7_BBC3-02      ----------------------------cccgaga-----------tgga
                                                                          

A0A2K5QXZ1_BIK-01       tcctgggtgt----------------------------------------
A0A2K5QQC6_PMAIP1-      acatga--------------------------------------------
A0A2K5Q1Y0_BCL2L11      agttgtcgtg----------------------------------------
A0A2K5Q1Y0_BCL2L11      agttgcggcg----------------------------------------
A0A2K5RN49_BMF-02       atgggg--------------------------------------------
A0A2K5RN49_BMF-01       atgggg--------------------------------------------
A0A2K5PDB1_BAD-01       ggatgagtgacgagttcgtggactcctttaagggacttcctcgcccgaag
A0A2K5PDB1_BAD-03       ggatga--------------------------------------------
A0A2K5PIE7_HRK-01       acttg--tag----------------------------------------
A0A2K5QNS7_BBC3-02      gcccaattag----------------------------------------
                                                                          

A0A2K5QXZ1_BIK-01       -------------------------cccgcaaacaggcagtgctgctggc
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       agcgcgggcacagcaacgcagatgcggcaaagcgccagctggacgcgagt
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5QXZ1_BIK-01       attcctggcgctgctgctggcgacgttcagcgggggtctgcacctgctgc
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      tag-----------------------------------------------
A0A2K5Q1Y0_BCL2L11      tatcggagacgagtttaacgcttattatccaaggaggatatctcttccat
A0A2K5RN49_BMF-02       ----caggcctgag------------------------------------
A0A2K5RN49_BMF-01       ----caggcctgaggtga--------------------------------
A0A2K5PDB1_BAD-01       catccagtcctggtgggatcggaacttgggcaggggaggatccgctccct
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5QXZ1_BIK-01       tcaagtga
A0A2K5QQC6_PMAIP1-      --------
A0A2K5Q1Y0_BCL2L11      --------
A0A2K5Q1Y0_BCL2L11      ctgattga
A0A2K5RN49_BMF-02       --------
A0A2K5RN49_BMF-01       --------
A0A2K5PDB1_BAD-01       cccagtga
A0A2K5PDB1_BAD-03       --------
A0A2K5PIE7_HRK-01       --------
A0A2K5QNS7_BBC3-02      --------
                                

© 1998-2020Legal notice