Dataset for CDS BCL2L11 of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5Q1Y0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1Y0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5Q1Y0_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1Y0_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
                        **************************************************

A0A2K5Q1Y0_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1Y0_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **************************************************

A0A2K5Q1Y0_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5Q1Y0_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                        **************************************************

A0A2K5Q1Y0_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5Q1Y0_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                        **************************************************

A0A2K5Q1Y0_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5Q1Y0_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
                        **************************************************

A0A2K5Q1Y0_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1Y0_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                        **************************************************

A0A2K5Q1Y0_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2K5Q1Y0_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
                        ******************************************** *    

A0A2K5Q1Y0_BCL2L11      -------------------------------------agagaaataga--
A0A2K5Q1Y0_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
                                                              **** ** **  

A0A2K5Q1Y0_BCL2L11      ----ggaagttgtcgtgtag------------------------------
A0A2K5Q1Y0_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
                               *****  * ***                               

A0A2K5Q1Y0_BCL2L11      -------------------------
A0A2K5Q1Y0_BCL2L11      gaggatatctcttccatctgattga
                                                 

© 1998-2020Legal notice