Dataset for CDS BAD of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5PDB1_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctc
A0A2K5PDB1_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctc
                       **************************************************

A0A2K5PDB1_BAD-03      tgcagagaggggcctgaaccccagcaccgcaggggacagccccccaggct
A0A2K5PDB1_BAD-01      tgcagagaggggcctgaaccccagcaccgcaggggacagccccccaggct
                       **************************************************

A0A2K5PDB1_BAD-03      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
A0A2K5PDB1_BAD-01      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
                       **************************************************

A0A2K5PDB1_BAD-03      cagcagggacagccaaccagcagcagccaccatggagagaatcccagtgc
A0A2K5PDB1_BAD-01      cagcagggacagccaaccagcagcagccacca------------------
                       ********************************                  

A0A2K5PDB1_BAD-03      aaggatgctctcgaaaacatcagcagggatgtcttccccagccactgact
A0A2K5PDB1_BAD-01      --------------------------------------------------
                                                                         

A0A2K5PDB1_BAD-03      cagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtgg
A0A2K5PDB1_BAD-01      ------------------------------tggaggcgctggggctgtgg
                                                     ********************

A0A2K5PDB1_BAD-03      agacccggagtcgccacagatcgtaccccgcagggacggaggaggacgaa
A0A2K5PDB1_BAD-01      agacccggagtcgccacagatcgtaccccgcagggacggaggaggacgaa
                       **************************************************

A0A2K5PDB1_BAD-03      gggatggaggaggagcccagcacctttcggggccgttcgcgctcggcacc
A0A2K5PDB1_BAD-01      gggatggaggaggagcccagcacctttcggggccgttcgcgctcggcacc
                       **************************************************

A0A2K5PDB1_BAD-03      ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
A0A2K5PDB1_BAD-01      ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
                       **************************************************

A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K5PDB1_BAD-01      gtgacgagttcgtggactcctttaagggacttcctcgcccgaagagcgcg
                                                                         

A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K5PDB1_BAD-01      ggcacagcaacgcagatgcggcaaagcgccagctggacgcgagtcatcca
                                                                         

A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K5PDB1_BAD-01      gtcctggtgggatcggaacttgggcaggggaggatccgctccctcccagt
                                                                         

A0A2K5PDB1_BAD-03      --
A0A2K5PDB1_BAD-01      ga
                         

© 1998-2020Legal notice