Dataset for CDS BIK of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F4W4K0_BIK-01      atg----ccccagggcgcagttaggcactacccgtccc---cgcggggca
A0A5F4W4K0_BIK-02      atggaaacccctgagtgcg---------cgcccgtctcgggcgcagggaa
                       ***    **** * * **            ****** *   *** *** *

A0A5F4W4K0_BIK-01      ggctgccgccc---------------------------------------
A0A5F4W4K0_BIK-02      aacagcgacgcacgagacaaagcaagtttgcagaacagcagggggcagag
                         * **  * *                                       

A0A5F4W4K0_BIK-01      ------------------cccacccctcccggaacctttctg--------
A0A5F4W4K0_BIK-02      aggccgtaaacaagccaaccggccgcacttgtagcggttctgttgctaat
                                         **  ** * *  * * *  *****        

A0A5F4W4K0_BIK-01      ----------------------atttatctctc-----------------
A0A5F4W4K0_BIK-02      gccattcagaccccagtccagcattccgcgctcggggtgcgagaggcagc
                                             ***   * ***                 

A0A5F4W4K0_BIK-01      ------------------cttggtgggtctctgg-----------ggtcc
A0A5F4W4K0_BIK-02      tcccggggcggggcggcgcggggcgggacccgggcggggcggggcgtccc
                                         *  ** *** * * **           *  **

A0A5F4W4K0_BIK-01      gtctcagcaggtctgccggtgggccccctgcccccaattc----tctccc
A0A5F4W4K0_BIK-02      ggtccattaggtcccgcgcgggtccccgggccgcagacacgacgcctctc
                       *   **  *****   **  ** ****  *** *  *  *     *** *

A0A5F4W4K0_BIK-01      ggtcccgcc-------------------ccgctcttgctgtccgggagcc
A0A5F4W4K0_BIK-02      ggctgggtcgcagactctgctatcatcgccgccaccgccgccgccgccgc
                       **    * *                   ****    ** * *   *   *

A0A5F4W4K0_BIK-01      cgcgaccg--gagggaggagaaatgtctgaagtaagacccctctccagtg
A0A5F4W4K0_BIK-02      cgccgccgccgccagaggagaaatgtctgaagtaagacccctctccagtg
                       ***  ***  *   ************************************

A0A5F4W4K0_BIK-01      acatcttcatggagaccctcctgtgtgagcagttcgtggatcccctgacc
A0A5F4W4K0_BIK-02      acatcttcatggagaccctcctgtgtgagcagttcgtggatcccctgacc
                       **************************************************

A0A5F4W4K0_BIK-01      atggaggttgttggtgggagtgaccctgaagaggacctggaccctgtgga
A0A5F4W4K0_BIK-02      atggaggttgttggtgggagtgaccctgaagaggacctggaccctgtgga
                       **************************************************

A0A5F4W4K0_BIK-01      ggaccctttggaatgcatggagaacagtgacgcactggccctgcagctgg
A0A5F4W4K0_BIK-02      ggaccctttggaatgcatggagaacagtgacgcactggccctgcagctgg
                       **************************************************

A0A5F4W4K0_BIK-01      cctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcc
A0A5F4W4K0_BIK-02      cctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcc
                       **************************************************

A0A5F4W4K0_BIK-01      cagctctacgaggtggccatgtacagcccgggtctcgctttcgtcctcga
A0A5F4W4K0_BIK-02      cagctctacgaggtggccatgtacagcccgggtctcgctttcgtcctcga
                       **************************************************

A0A5F4W4K0_BIK-01      ccggaccgacatcggggatgttcttagcggtgtcgtggatgttttcgcta
A0A5F4W4K0_BIK-02      ccggaccgacatcggggatgttcttagcggtgtcgtggatgttttcgcta
                       **************************************************

A0A5F4W4K0_BIK-01      acttccaggaggacatagtgaggctctggagatccctgagctccgggtcc
A0A5F4W4K0_BIK-02      acttccaggaggacatagtgaggctctggagatccctgagctccgggtcc
                       **************************************************

A0A5F4W4K0_BIK-01      tgggtgtcccgcaaacaggcagtgctgctagcactcctggcgctgctgct
A0A5F4W4K0_BIK-02      tgggtgtcccgcaaacaggcagtgctgctagcactcctggcgctgctgct
                       **************************************************

A0A5F4W4K0_BIK-01      ggcgatgttcagtgggggtctgcacctgctgctcaagtga
A0A5F4W4K0_BIK-02      ggcgatgttcagtgggggtctgcacctgctgctcaagtga
                       ****************************************

© 1998-2022Legal notice