Dataset for CDS BIK of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7FUT7_BIK-02      atggaaacccctgagtgcg---------cgcccgtctcgggcgcagggaaaacagcgacg
F7FUT7_BIK-01      atg----ccccagggcgcagttaggcactacccgtccc---cgcggggcaggctgccgcc
                   ***    **** * * **            ****** *   *** *** *  * **  * 

F7FUT7_BIK-02      cacgagacaaagcaagtttgcagaacagcagggggcagagaggccgtaaacaagccaacc
F7FUT7_BIK-01      c---------------------------------------------------------cc
                   *                                                         **

F7FUT7_BIK-02      ggccgcacttgtagcggttctgttgctaatgccattcagaccccagtccagcattccgcg
F7FUT7_BIK-01      cacccctcccggaacctttctg------------------------------atttatct
                     ** * *  * * *  *****                              ***   * 

F7FUT7_BIK-02      ctcggggtgcgagaggcagctcccggggcggggcggcgcggggcgggacccgggcggggc
F7FUT7_BIK-01      ctc-----------------------------------cttggtgggtctctgg------
                   ***                                   *  ** *** * * **      

F7FUT7_BIK-02      ggggcgtcccggtccattaggtcccgcgcgggtccccgggccgcagacacgacgcctctc
F7FUT7_BIK-01      -----ggtccgtctcagcaggtctgccggtgggccccctgcccccaattc----tctccc
                        *  ***   **  *****   **  ** ****  *** *  *  *     *** *

F7FUT7_BIK-02      ggctgggtcgcagactctgctatcatcgccgccaccgccgccgccgccgccgccgccgcc
F7FUT7_BIK-01      ggtcccgcc-------------------ccgctcttgctgtccgggagcccgcgaccg--
                   **    * *                   ****    ** * *   *   ****  ***  

F7FUT7_BIK-02      gccagaggagaaatgtctgaagtaagacccctctccagtgacatcttcatggagaccctc
F7FUT7_BIK-01      gagggaggagaaatgtctgaagtaagacccctctccagtgacatcttcatggagaccctc
                   *   ********************************************************

F7FUT7_BIK-02      ctgtgtgagcagttcgtggatcccctgaccatggaggttgttggtgggagtgaccctgaa
F7FUT7_BIK-01      ctgtgtgagcagttcgtggatcccctgaccatggaggttgttggtgggagtgaccctgaa
                   ************************************************************

F7FUT7_BIK-02      gaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacgcactggcc
F7FUT7_BIK-01      gaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacgcactggcc
                   ************************************************************

F7FUT7_BIK-02      ctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcc
F7FUT7_BIK-01      ctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcc
                   ************************************************************

F7FUT7_BIK-02      cagctctacgaggtggccatgtacagcccgggtctcgctttcgtcctcgaccggaccgac
F7FUT7_BIK-01      cagctctacgaggtggccatgtacagcccgggtctcgctttcgtcctcgaccggaccgac
                   ************************************************************

F7FUT7_BIK-02      atcggggatgttcttagcggtgtcgtggatgttttcgctaacttccaggaggacatagtg
F7FUT7_BIK-01      atcggggatgttcttagcggtgtcgtggatgttttcgctaacttccaggaggacatagtg
                   ************************************************************

F7FUT7_BIK-02      aggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcagtgctgcta
F7FUT7_BIK-01      aggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcagtgctgcta
                   ************************************************************

F7FUT7_BIK-02      gcactcctggcgctgctgctggcgatgttcagtgggggtctgcacctgctgctcaagtga
F7FUT7_BIK-01      gcactcctggcgctgctgctggcgatgttcagtgggggtctgcacctgctgctcaagtga
                   ************************************************************

© 1998-2020Legal notice