Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccagg
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      atggccc-------------------------------------------
Q05KI3_BMF-02           atggagc-------------------------------------------
Q05KI3_BMF-01           atggagc-------------------------------------------
F1MUT9_BAD-01           atgttcc-------------------------------------------
Q3SYZ0_BAD-01           atgttcc-------------------------------------------
                                                                          

A0A3Q1MV27_BCL2L11      ----------------------------------------------atgg
A0A3Q1MV27_BCL2L11      agccggcttgggggaccttgctcccattcggagaaaaaaagaccaaatgg
A0A3Q1NFP6_PMAIP1-      ---------------------------------------atgcctg----
A0A3Q1LXZ6_BBC3-01      -----------------------------------gagcacgccag----
Q05KI3_BMF-02           -----------------------------------c---accccagtgtg
Q05KI3_BMF-01           -----------------------------------c---accccagtgtg
F1MUT9_BAD-01           -----------------------------------ag--atcccagagt-
Q3SYZ0_BAD-01           -----------------------------------ag--atcccagagt-
                                                                          

A0A3Q1MV27_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A3Q1MV27_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A3Q1NFP6_PMAIP1-      --------------gaaggagg----------------------------
A0A3Q1LXZ6_BBC3-01      gagggcagctccccggagcccgtagagggcctggcccgc-----gacggc
Q05KI3_BMF-02           tggaggagct----ggaggatgacgtattccagccc-gaggatggggagc
Q05KI3_BMF-01           tggaggagct----ggaggatgacgtattccagccc-gaggatggggagc
F1MUT9_BAD-01           ttgagcagag----tgagcaggaag-actccagccctgcagataggg-gc
Q3SYZ0_BAD-01           ttgagcagag----tgagcaggaag-actccagccgtgcagataggg-gc
                                         *   *                            

A0A3Q1MV27_BCL2L11      ttg-----cagcctgccgagaggcctc-----------------------
A0A3Q1MV27_BCL2L11      ttg-----cagcctgccgagaggcctc-----------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ccgcgccccttcccgctcagccgcctggtgccctcggcggtgtcctgcgg
Q05KI3_BMF-02           cggggacccagccc----aggagcttg-----ctctctgctgacctgttt
Q05KI3_BMF-01           cggggacccagccc----aggagcttg-----ctctctgctgacctgttt
F1MUT9_BAD-01           ctgggccccagccccacaggggacagg-----cccccaggt---------
Q3SYZ0_BAD-01           ctgggccccagccccacaggggacagg-----cccccaggt---------
                                                                          

A0A3Q1MV27_BCL2L11      -ctcagc-------tcagacctggggcccccacctctttac---------
A0A3Q1MV27_BCL2L11      -ctcagc-------tcagacctggggcccccacctctttac---------
A0A3Q1NFP6_PMAIP1-      --------------gctcgtaagagcgcccagccg---------------
A0A3Q1LXZ6_BBC3-01      cctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgctgc
Q05KI3_BMF-02           gcccagagcca---gctggactgccccctcagccgtct-------gcagc
Q05KI3_BMF-01           gcccagagcca---gctggactgccccctcagccgtct-------gcagc
F1MUT9_BAD-01           -ctcagcaagc---actggctaacagccccaggcctcctgg--gggaagc
Q3SYZ0_BAD-01           -ctcagcaagc---actggctaacagccccaggcctcctgg--gggaagc
                                       *           * *   *                

A0A3Q1MV27_BCL2L11      -------------agacagagcggcaa-----gacaggagcccggcaccc
A0A3Q1MV27_BCL2L11      -------------agacagagcggcaa-----gacaggagcccggcaccc
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgcc
Q05KI3_BMF-02           tcttccctctc--acgcactgctgtggccctgggcttcgacccaccagcc
Q05KI3_BMF-01           tcttccctctc--acgcactgctgtggccctgggcttcgacccaccagcc
F1MUT9_BAD-01           tggtcaccagc--aggggcagc--cggcc---ggcagcagcc-----acc
Q3SYZ0_BAD-01           tggtcaccagc--aggggcagc--cggcc---ggcagcagcc-----acc
                                                                          

A0A3Q1MV27_BCL2L11      atgagttgtgaca-------aatccacacagaccccaagccctccttg--
A0A3Q1MV27_BCL2L11      atgagttgtgaca-------aatccacacagaccccaagccctccttg--
A0A3Q1NFP6_PMAIP1-      ---------agccccacgcgggtcccggcagatcc---------------
A0A3Q1LXZ6_BBC3-01      ctggg----ggccccccgctggcctgggggtccccgcagccggccccgag
Q05KI3_BMF-02           aggaa----gaca-------aggctacccagactc----tcagcccag--
Q05KI3_BMF-01           aggaa----gaca-------aggctacccagactc----tcagcccag--
F1MUT9_BAD-01           atgga----ggcac----tggggctgtggagacccggagtcgtcacag--
Q3SYZ0_BAD-01           atgga----ggcac----tggggctgtggagacccggagtcgtcacag--
                                   *           *          *               

A0A3Q1MV27_BCL2L11      ------------------ccaggccttcaaccattatctcagtgcaat--
A0A3Q1MV27_BCL2L11      ------------------ccaggccttcaaccattatctcagtgcaat--
A0A3Q1NFP6_PMAIP1-      ---------------------------------------tgaagttga--
A0A3Q1LXZ6_BBC3-01      gcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcac
Q05KI3_BMF-02           --cttcccc------gagccagggtgtcatgctgccttgtggggtgac--
Q05KI3_BMF-01           --cttcccc------gagccagggtgtcatgctgccttgtggggtgac--
F1MUT9_BAD-01           --ctcctaccgcgcggggccagaggataa----------tgaagagac--
Q3SYZ0_BAD-01           --ctcctaccgcgcggggccagaggataa----------tgaagagac--
                                                                   *      

A0A3Q1MV27_BCL2L11      ------------------------------------------------gg
A0A3Q1MV27_BCL2L11      ------------------------------------------------gg
A0A3Q1NFP6_PMAIP1-      -----------------------------atgtgccattc----------
A0A3Q1LXZ6_BBC3-01      ctggaatcaccagtgcccagcgcccc---gggggcc---ctggcgggcgg
Q05KI3_BMF-02           --tgaggag-----ccccagcgactcttttatggccatgctggctaccgg
Q05KI3_BMF-01           --tgaggag-----ccccagcgactcttttatggccatgctggctaccgg
F1MUT9_BAD-01           --ggaggaggaggatctcggc--ccctttaggggcc--gctcgcgttcgg
Q3SYZ0_BAD-01           --ggaggaggaggatctcggc--ccctttaggggcc--gctcgcgttcgg
                                                                          

A0A3Q1MV27_BCL2L11      cttccat----------------------------------gaggcagtc
A0A3Q1MV27_BCL2L11      cttccat----------------------------------gaggcagtc
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ccccacc----------------------------------caagcggcc
Q05KI3_BMF-02           ctcccccttcctgccagtttccctgcaggcttgccccttggtgagcagcc
Q05KI3_BMF-01           ctcccccttcctgccagtttccctgcaggcttgccccttggtgagcagcc
F1MUT9_BAD-01           cgccccc--------------------------------------caacc
Q3SYZ0_BAD-01           cgccccc--------------------------------------caacc
                                                                          

A0A3Q1MV27_BCL2L11      tcaggctgtacctgcagatacacgcccagagatatggattgcccaag---
A0A3Q1MV27_BCL2L11      tcaggctgtacctgcagatacacgcccagagatatggattgcccaag---
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      cc--gggagtccggggggaggaggagcagtgggcccgagagatcggggcc
Q05KI3_BMF-02           ccctgaagggcagtggcaacatcgagcagagatacagattgcccgaa---
Q05KI3_BMF-01           ccctgaagggcagtggcaacatcgagcagagatacagattgcccgaa---
F1MUT9_BAD-01           tct----gggc-----------tgcacagcgata-----tggccgcg---
Q3SYZ0_BAD-01           tct----gggc-----------tgcacagcgata-----tggccgcg---
                                                                          

A0A3Q1MV27_BCL2L11      -agctacggcgtatcggagacgagtttaatgcatatt-------------
A0A3Q1MV27_BCL2L11      -agctacggcgtatcggagacgagtttaatgcatatt-------------
A0A3Q1NFP6_PMAIP1-      -agttgaggagaattggagacaaactgaatttc-----------------
A0A3Q1LXZ6_BBC3-01      cagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggag
Q05KI3_BMF-02           -aactccagtgcattgcagaccagttcca--tcggcttc-atatgcagca
Q05KI3_BMF-01           -aactccagtgcattgcagaccagttcca--tcggcttc-atatgcagca
F1MUT9_BAD-01           -agctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcc
Q3SYZ0_BAD-01           -aactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcc
                         *  *   * * **    *** *  *  *                     

A0A3Q1MV27_BCL2L11      acccaagaagggtcttcgtgcgtcaccag-----gcagttgagggccacc
A0A3Q1MV27_BCL2L11      acccaagaagggtcttcgtgcgtcaccag-----gcagttgagggccacc
A0A3Q1NFP6_PMAIP1-      -cggcagaaacttgtgaatctgatatccaaa-------------------
A0A3Q1LXZ6_BBC3-01      acaagaggag----------cggca---------gcgac--accgccc--
Q05KI3_BMF-02           ataccagcagaac-------cgaaatcgcatgtggtggc--agatcctc-
Q05KI3_BMF-01           ataccagcagaac-------cgaaatcgcatgtggtggc--agatcctc-
F1MUT9_BAD-01           tcgcccgaagagcgcgggcacggcaacgcaaat-gcgac--aaagcccca
Q3SYZ0_BAD-01           tcgcccgaagagcgcgggcacggcaacggaaat-gcgac--aaagcccca
                              * *            *  *                         

A0A3Q1MV27_BCL2L11      cgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtctggtgt--
A0A3Q1MV27_BCL2L11      cgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtctggtgt--
A0A3Q1NFP6_PMAIP1-      --------ctcctccgc---------------------------------
A0A3Q1LXZ6_BBC3-01      --------ctcaccctggagggtcctgtacaatctcatcatgggactcct
Q05KI3_BMF-02           --------ctcttcctacacaacgtggctttgaatggagatgaga-----
Q05KI3_BMF-01           --------ctcttcctacacaacgtggctttgaatggagatgaga-----
F1MUT9_BAD-01           gctggacgcgcttcctcca-gtcctggttgagccggaacttgggg-----
Q3SYZ0_BAD-01           gctggacgcgcttcctcca-gtcctggttgagccggaacttgggg-----
                                  *  *                                    

A0A3Q1MV27_BCL2L11      --------ggaggatgc-------------agtga-----------
A0A3Q1MV27_BCL2L11      --------ggaggatgc-------------agtga-----------
A0A3Q1NFP6_PMAIP1-      --------tcaggaact---------------tga-----------
A0A3Q1LXZ6_BBC3-01      gccctttcccgggggccgcggagcccccgaggtggagcccaattag
Q05KI3_BMF-02           --------acagga-acggggcaggccccaggtga-----------
Q05KI3_BMF-01           --------acagga-acggggcaggccccaggtga-----------
F1MUT9_BAD-01           --------agaggaggctccgccccctcccagtga-----------
Q3SYZ0_BAD-01           --------agaggaggctccgccccctcccagtga-----------
                                   **                   **            

© 1998-2020Legal notice