Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2EII1_BMF-01       --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
A0A4W2INA4_BMF-01       --------------------------------------------------
A0A4W2C9A8_BAD-01       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccagg
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W2EII1_BMF-01       ----------------------------------------------atgg
Q05KI3_BMF-01           ----------------------------------------------atgg
Q05KI3_BMF-02           ----------------------------------------------atgg
A0A4W2INA4_BMF-01       ----------------------------------------------atgg
A0A4W2C9A8_BAD-01       ----------------------------------------------atgt
F1MUT9_BAD-01           ----------------------------------------------atgt
Q3SYZ0_BAD-01           ----------------------------------------------atgt
A0A4W2CRW4_HRK-01       ----------------------------------------------atg-
A0A4W2GVZ3_HRK-01       ----------------------------------------------atg-
A0A3Q1LXZ6_BBC3-01      ----------------------------------------------atgg
A0A4W2EKD9_BBC3-02      ----------------------------------------------atgg
A0A4W2EKD9_BBC3-01      ----------------------------------------------gtga
A0A3Q1NFP6_PMAIP1-      ----------------------------------------------at--
A0A4W2CDL0_PMAIP1-      ----------------------------------------------at--
A0A4W2D2G6_BCL2L11      ----------------------------------------------atgg
A0A4W2D2G6_BCL2L11      ----------------------------------------------atgg
A0A3Q1MV27_BCL2L11      agccggcttgggggaccttgctcccattcggagaaaaaaagaccaaatgg
A0A3Q1MV27_BCL2L11      ----------------------------------------------atgg
A0A4W2G3J8_BCL2L11      ----------------------------------------------atgg
A0A3Q1MV27_BCL2L11      ----------------------------------------------atgg
A0A4W2G3J8_BCL2L11      ----------------------------------------------atgg
                                                                       *  

A0A4W2EII1_BMF-01       agc---------------------caccccagtgtgtggaggagctggag
Q05KI3_BMF-01           agc---------------------caccccagtgtgtggaggagctggag
Q05KI3_BMF-02           agc---------------------caccccagtgtgtggaggagctggag
A0A4W2INA4_BMF-01       agc---------------------caccccagtgtgtggaggagctggag
A0A4W2C9A8_BAD-01       tccaga------------------tcccagagtttgagcagagt---gag
F1MUT9_BAD-01           tccaga------------------tcccagagtttgagcagagt---gag
Q3SYZ0_BAD-01           tccaga------------------tcccagagtttgagcagagt---gag
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      cccgagcacgccaggagggcagctccccggagcccgtagagggcctggcc
A0A4W2EKD9_BBC3-02      cccgagcacgccaggagggcagctccccggagcccgtagagggcctggcc
A0A4W2EKD9_BBC3-01      -----------------------------gagccactgcagaggct-gcc
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
A0A4W2D2G6_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
A0A3Q1MV27_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
A0A3Q1MV27_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
A0A4W2G3J8_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
A0A3Q1MV27_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
A0A4W2G3J8_BCL2L11      caaagcaacc--------------ttccgatgtaagttctgagtgtgaca
                                                                          

A0A4W2EII1_BMF-01       gatgacgtattccagcccgaggatggggagccggggacccagcc---cag
Q05KI3_BMF-01           gatgacgtattccagcccgaggatggggagccggggacccagcc---cag
Q05KI3_BMF-02           gatgacgtattccagcccgaggatggggagccggggacccagcc---cag
A0A4W2INA4_BMF-01       gatgacgtattccagcccgaggatggggagccggggacccagcc---cag
A0A4W2C9A8_BAD-01       caggaag-actccagccctgcagataggggcctgggccccagccccacag
F1MUT9_BAD-01           caggaag-actccagccctgcagataggggcctgggccccagccccacag
Q3SYZ0_BAD-01           caggaag-actccagccgtgcagataggggcctgggccccagccccacag
A0A4W2CRW4_HRK-01       ------t-gcccgtgccc------------cctgcaccgcggccgc---g
A0A4W2GVZ3_HRK-01       ------t-gcccgtgccc------------cctgcaccgcggccgc---g
A0A3Q1LXZ6_BBC3-01      cgcgacg-gcccgcgccc------------cttcccgctcagccgcctgg
A0A4W2EKD9_BBC3-02      cgcgacg-gcccgcgccc------------cttcccgctcagccgcctgg
A0A4W2EKD9_BBC3-01      cgggcat-gtccgtgc-----------------------cagctgcccgg
A0A3Q1NFP6_PMAIP1-      -----------------------------gcctggaaggagggctcgtaa
A0A4W2CDL0_PMAIP1-      -----------------------------gcctggaaggagggctcgtaa
A0A4W2D2G6_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
A0A4W2D2G6_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
A0A3Q1MV27_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
A0A3Q1MV27_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
A0A4W2G3J8_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
A0A3Q1MV27_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
A0A4W2G3J8_BCL2L11      gagaagg----------tggacaattgcagcctgccgagaggcctcctca
                                                                 *        

A0A4W2EII1_BMF-01       gagcttgctctctgctgacctgtttgcccagagccagctg----------
Q05KI3_BMF-01           gagcttgctctctgctgacctgtttgcccagagccagctg----------
Q05KI3_BMF-02           gagcttgctctctgctgacctgtttgcccagagccagctg----------
A0A4W2INA4_BMF-01       gagcttgctctctgctgacctgtttgcccagagccagctg----------
A0A4W2C9A8_BAD-01       g------ggacaggcccccaggtctcagcaagcactg-------------
F1MUT9_BAD-01           g------ggacaggcccccaggtctcagcaagcactg-------------
Q3SYZ0_BAD-01           g------ggacaggcccccaggtctcagcaagcactg-------------
A0A4W2CRW4_HRK-01       gccccccggccgtgtgc---------------------------------
A0A4W2GVZ3_HRK-01       gccccccggccgtgtgc---------------------------------
A0A3Q1LXZ6_BBC3-01      tgccctcggcggtgtcctgcggcctctgcgaacccggcct----------
A0A4W2EKD9_BBC3-02      tgccctcggcggtgtcctgcggcctctgcgaacccggcct----------
A0A4W2EKD9_BBC3-01      ggcttt--------------------------------------------
A0A3Q1NFP6_PMAIP1-      -----------gagcgcccagcc---------------------------
A0A4W2CDL0_PMAIP1-      -----------gagcgcccagcc---------------------------
A0A4W2D2G6_BCL2L11      gctcagaccgggggcccccacctctttacagacagagcggca--------
A0A4W2D2G6_BCL2L11      gctcagaccgggggcccccacctctttacagacagagcggcaaggtaatc
A0A3Q1MV27_BCL2L11      gctcagacctggggcccccacctctttacagacagagcggca--------
A0A3Q1MV27_BCL2L11      gctcagacctggggcccccacctctttacagacagagcggca--------
A0A4W2G3J8_BCL2L11      gctcagacctggggcccccacctctttacagacagagcggca--------
A0A3Q1MV27_BCL2L11      gctcagacctggggcccccacctctttacagacagagcggcaaggtaatc
A0A4W2G3J8_BCL2L11      gctcagacctggggcccccacctctttacagacagagcggcaaggtaatc
                                                                          

A0A4W2EII1_BMF-01       ------------------------------------------gactgccc
Q05KI3_BMF-01           ------------------------------------------gactgccc
Q05KI3_BMF-02           ------------------------------------------gactgccc
A0A4W2INA4_BMF-01       ------------------------------------------gactgccc
A0A4W2C9A8_BAD-01       ------------------------------------------gctaacag
F1MUT9_BAD-01           ------------------------------------------gctaacag
Q3SYZ0_BAD-01           ------------------------------------------gctaacag
A0A4W2CRW4_HRK-01       ------------------------------------------gcctgcag
A0A4W2GVZ3_HRK-01       ------------------------------------------gcctgcag
A0A3Q1LXZ6_BBC3-01      ------------------------------------------gcctgctg
A0A4W2EKD9_BBC3-02      ------------------------------------------gcctgctg
A0A4W2EKD9_BBC3-01      --------------------------------------------cttctc
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      ctgaaggagaaggggaccgctgcctccaaggcagcccacagggcccgctg
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      ctgaaggagaaggggaccgctgcccccaaggcagcccacagggcccgctg
A0A4W2G3J8_BCL2L11      ctgaaggagaaggggaccgctgcccccaaggcagcccacagggcccgctg
                                                                          

A0A4W2EII1_BMF-01       cctcagccgtctgc------------------------------------
Q05KI3_BMF-01           cctcagccgtctgc------------------------------------
Q05KI3_BMF-02           cctcagccgtctgc------------------------------------
A0A4W2INA4_BMF-01       cctcagccgtctgc------------------------------------
A0A4W2C9A8_BAD-01       cccc----------------------------------------------
F1MUT9_BAD-01           cccc----------------------------------------------
Q3SYZ0_BAD-01           cccc----------------------------------------------
A0A4W2CRW4_HRK-01       cgccggccgcct--------------------------------------
A0A4W2GVZ3_HRK-01       cgccggccgcct--------------------------------------
A0A3Q1LXZ6_BBC3-01      cccccgccgcccccgccctgctgcccgccgcctacctctgcgcccccacc
A0A4W2EKD9_BBC3-02      cccccgccgcccccgccctgctgcccgccgcctacctctgcgcccccacc
A0A4W2EKD9_BBC3-01      cccct---------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      gccccaccggccagccctggccctttcgctaccagatccccgctcttcat
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      gccccaccggccagccctggccctttcgctaccagatccccgctcttcat
A0A4W2G3J8_BCL2L11      gccccaccggccagccctggccctttcgctaccagatccccgctcttcat
                                                                          

A0A4W2EII1_BMF-01       ----------------------------agctcttcc-------------
Q05KI3_BMF-01           ----------------------------agctcttcc-------------
Q05KI3_BMF-02           ----------------------------agctcttcc-------------
A0A4W2INA4_BMF-01       ----------------------------agctcttcc-------------
A0A4W2C9A8_BAD-01       ----------------------------aggcctcctggggga-------
F1MUT9_BAD-01           ----------------------------aggcctcctggggga-------
Q3SYZ0_BAD-01           ----------------------------aggcctcctggggga-------
A0A4W2CRW4_HRK-01       ----------------------------gggtc-----------------
A0A4W2GVZ3_HRK-01       ----------------------------gggtc-----------------
A0A3Q1LXZ6_BBC3-01      gccccgcccgccgtcaccgccgccctgggggccccccgctggcctggggg
A0A4W2EKD9_BBC3-02      gccccgcccgccgtcaccgccgccctgggggccccccgctggcctggggg
A0A4W2EKD9_BBC3-01      ----------------------------gggtcccccaccagattcg---
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      cttcgtgagaagatcctccttgctgtctcgatcctccagtgggt------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      cttcgtgagaagatcctccttgctgtctcgatcctccagtgggt------
A0A4W2G3J8_BCL2L11      cttcgtgagaagatcctccttgctgtctcgatcctccagtgggt------
                                                                          

A0A4W2EII1_BMF-01       ------------------------------ctctcacgcactgctgtggc
Q05KI3_BMF-01           ------------------------------ctctcacgcactgctgtggc
Q05KI3_BMF-02           ------------------------------ctctcacgcactgctgtggc
A0A4W2INA4_BMF-01       ------------------------------ctctcacgcactgctgtggc
A0A4W2C9A8_BAD-01       ------------------------------agctggtcaccagcaggggc
F1MUT9_BAD-01           ------------------------------agctggtcaccagcaggggc
Q3SYZ0_BAD-01           ------------------------------agctggtcaccagcaggggc
A0A4W2CRW4_HRK-01       -----------------------------------------------tgc
A0A4W2GVZ3_HRK-01       -----------------------------------------------tgc
A0A3Q1LXZ6_BBC3-01      tccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcac
A0A4W2EKD9_BBC3-02      tccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcac
A0A4W2EKD9_BBC3-01      ---------------------------------tggtcctcagccttcac
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      ----------------------------------------------agac
A0A4W2D2G6_BCL2L11      ------------------------------atttctcttttgacacagac
A0A3Q1MV27_BCL2L11      ----------------------------------------------agac
A0A3Q1MV27_BCL2L11      ----------------------------------------------agac
A0A4W2G3J8_BCL2L11      ----------------------------------------------agac
A0A3Q1MV27_BCL2L11      ------------------------------atttctcttttgacacagac
A0A4W2G3J8_BCL2L11      ------------------------------atttctcttttgacacagac
                                                                          

A0A4W2EII1_BMF-01       cctgggcttcgacccaccagc---caggaagacaaggctacccagactct
Q05KI3_BMF-01           cctgggcttcgacccaccagc---caggaagacaaggctacccagactct
Q05KI3_BMF-02           cctgggcttcgacccaccagc---caggaagacaaggctacccagactct
A0A4W2INA4_BMF-01       cctgggcttcgacccaccagc---caggaagacaaggctacccagactct
A0A4W2C9A8_BAD-01       agccggccg----gcagcagccaccatggaggcactggggctgtggagac
F1MUT9_BAD-01           agccggccg----gcagcagccaccatggaggcactggggctgtggagac
Q3SYZ0_BAD-01           agccggccg----gcagcagccaccatggaggcactggggctgtggagac
A0A4W2CRW4_HRK-01       gctcgtccgccgcgcagc-------------tcac---------------
A0A4W2GVZ3_HRK-01       gctcgtccgccgcgcagc-------------tcac---------------
A0A3Q1LXZ6_BBC3-01      tctcgcccgcggagcagca-----cctggaatcaccagtgcccagcgccc
A0A4W2EKD9_BBC3-02      tctcgcccgcggagcagca-----cctggaatcaccagtgcccagcgccc
A0A4W2EKD9_BBC3-01      tctcgcccgcggagcagca-----cctggaatcaccagtgcccagcgccc
A0A3Q1NFP6_PMAIP1-      --gagcc------------------------ccacgcgggtccc------
A0A4W2CDL0_PMAIP1-      --gagcc------------------------ccacgcgggtccc------
A0A4W2D2G6_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
A0A4W2D2G6_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
A0A3Q1MV27_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
A0A3Q1MV27_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
A0A4W2G3J8_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
A0A3Q1MV27_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
A0A4W2G3J8_BCL2L11      aggagcccggcacccatgagttgtgacaaatccacacagaccccaagccc
                            * *                         **                

A0A4W2EII1_BMF-01       cag-------------cccagcttccccgagccagggtgtcatgctgcct
Q05KI3_BMF-01           cag-------------cccagcttccccgagccagggtgtcatgctgcct
Q05KI3_BMF-02           cag-------------cccagcttccccgagccagggtgtcatgctgcct
A0A4W2INA4_BMF-01       cag-------------cccagcttccccgagccagggtgtcatgctgcct
A0A4W2C9A8_BAD-01       ccggagtcgtcacagctcctaccgcgcggggccagaggataatgaagaga
F1MUT9_BAD-01           ccggagtcgtcacagctcctaccgcgcggggccagaggataatgaagaga
Q3SYZ0_BAD-01           ccggagtcgtcacagctcctaccgcgcggggccagaggataatgaagaga
A0A4W2CRW4_HRK-01       --------------g-----gcagcccggctcaaggcgctc---------
A0A4W2GVZ3_HRK-01       --------------g-----gcagcccggctcaaggcgctc---------
A0A3Q1LXZ6_BBC3-01      cgggggccctggcgg-----gcggccccacccaagcggccccgggagtcc
A0A4W2EKD9_BBC3-02      cgggggccctggcgg-----gcggccccacccaagcggccccgggagtcc
A0A4W2EKD9_BBC3-01      cgggggccctggcgg-----gcggccccacccaagcggccccgggagtcc
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
A0A4W2D2G6_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
A0A3Q1MV27_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
A0A3Q1MV27_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
A0A4W2G3J8_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
A0A3Q1MV27_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
A0A4W2G3J8_BCL2L11      tccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggc
                                                                          

A0A4W2EII1_BMF-01       tgtggggtgactgaggagccccagcgactcttttatggccatgctggcta
Q05KI3_BMF-01           tgtggggtgactgaggagccccagcgactcttttatggccatgctggcta
Q05KI3_BMF-02           tgtggggtgactgaggagccccagcgactcttttatggccatgctggcta
A0A4W2INA4_BMF-01       tgtggggtgactgaggagccccagcgactcttttatggcaatgctggcta
A0A4W2C9A8_BAD-01       cggag-------gaggaggatctcggcccctttaggggcc--gctcgcgt
F1MUT9_BAD-01           cggag-------gaggaggatctcggcccctttaggggcc--gctcgcgt
Q3SYZ0_BAD-01           cggag-------gaggaggatctcggcccctttaggggcc--gctcgcgt
A0A4W2CRW4_HRK-01       --ggc-------gacgagctgc-----------a----------------
A0A4W2GVZ3_HRK-01       --ggc-------gacgagctgc-----------a----------------
A0A3Q1LXZ6_BBC3-01      ggggg-------gaggaggagc-----------agtgggc--ccgagaga
A0A4W2EKD9_BBC3-02      ggggg-------gaggaggagc-----------agtgggc--ccgagaga
A0A4W2EKD9_BBC3-01      ggggg-------gaggaggagc-----------agtgggc--ccgagaga
A0A3Q1NFP6_PMAIP1-      --------------ggcagatc---------------------ctgaagt
A0A4W2CDL0_PMAIP1-      --------------ggcagatc---------------------ctgaagt
A0A4W2D2G6_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
A0A4W2D2G6_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
A0A3Q1MV27_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
A0A3Q1MV27_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
A0A4W2G3J8_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
A0A3Q1MV27_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
A0A4W2G3J8_BCL2L11      agtct-------caggctgtac---------------------ctgcaga
                                       *     *                            

A0A4W2EII1_BMF-01       ccggctcccccttcctgccagtttccctgcaggcttgccccttggtgagc
Q05KI3_BMF-01           ccggctcccccttcctgccagtttccctgcaggcttgccccttggtgagc
Q05KI3_BMF-02           ccggctcccccttcctgccagtttccctgcaggcttgccccttggtgagc
A0A4W2INA4_BMF-01       ccggctcccccttcctgccagtttccctgcaggcttgccccttggtgagc
A0A4W2C9A8_BAD-01       tcggcgccccccaacctc--------------------------------
F1MUT9_BAD-01           tcggcgccccccaacctc--------------------------------
Q3SYZ0_BAD-01           tcggcgccccccaacctc--------------------------------
A0A4W2CRW4_HRK-01       -------cc-----------------------------------------
A0A4W2GVZ3_HRK-01       -------cc-----------------------------------------
A0A3Q1LXZ6_BBC3-01      tcggggccc-----------------------------------------
A0A4W2EKD9_BBC3-02      tcggggccc-----------------------------------------
A0A4W2EKD9_BBC3-01      tcggggccc-----------------------------------------
A0A3Q1NFP6_PMAIP1-      tgaatg--------------------------------------------
A0A4W2CDL0_PMAIP1-      tgaatg--------------------------------------------
A0A4W2D2G6_BCL2L11      tacacgccc-----------------------------------------
A0A4W2D2G6_BCL2L11      tacacgccc-----------------------------------------
A0A3Q1MV27_BCL2L11      tacacgccc-----------------------------------------
A0A3Q1MV27_BCL2L11      tacacgccc-----------------------------------------
A0A4W2G3J8_BCL2L11      tacacgccc-----------------------------------------
A0A3Q1MV27_BCL2L11      tacacgccc-----------------------------------------
A0A4W2G3J8_BCL2L11      tacacgccc-----------------------------------------
                                                                          

A0A4W2EII1_BMF-01       agccccctgaagggcagtggcaacatcgagcagagatacagattgcccga
Q05KI3_BMF-01           agccccctgaagggcagtggcaacatcgagcagagatacagattgcccga
Q05KI3_BMF-02           agccccctgaagggcagtggcaacatcgagcagagatacagattgcccga
A0A4W2INA4_BMF-01       agccccctgaagggcagtggcaacatcgagcagagatacagattgcccga
A0A4W2C9A8_BAD-01       --------------------------tgggctgcacagcgatatggccgc
F1MUT9_BAD-01           --------------------------tgggctgcacagcgatatggccgc
Q3SYZ0_BAD-01           --------------------------tgggctgcacagcgatatggccgc
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      -------------------------------------------tgccatt
A0A4W2CDL0_PMAIP1-      -------------------------------------------tgccatt
A0A4W2D2G6_BCL2L11      -------------------------------agagatatggattgcccaa
A0A4W2D2G6_BCL2L11      -------------------------------agagatatggattgcccaa
A0A3Q1MV27_BCL2L11      -------------------------------agagatatggattgcccaa
A0A3Q1MV27_BCL2L11      -------------------------------agagatatggattgcccaa
A0A4W2G3J8_BCL2L11      -------------------------------agagatatggattgcccaa
A0A3Q1MV27_BCL2L11      -------------------------------agagatatggattgcccaa
A0A4W2G3J8_BCL2L11      -------------------------------agagatatggattgcccaa
                                                                          

A0A4W2EII1_BMF-01       aaactccagtgcattgcagaccagttccatcggcttcatatgcagcaata
Q05KI3_BMF-01           aaactccagtgcattgcagaccagttccatcggcttcatatgcagcaata
Q05KI3_BMF-02           aaactccagtgcattgcagaccagttccatcggcttcatatgcagcaata
A0A4W2INA4_BMF-01       aaactccagtgcattgcagaccagttccatcggcttcatatgcagcaata
A0A4W2C9A8_BAD-01       gagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcc
F1MUT9_BAD-01           gagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcc
Q3SYZ0_BAD-01           gaactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcc
A0A4W2CRW4_HRK-01       -agc-gcaccatgtggcgg-------cgccgcgc----------g-----
A0A4W2GVZ3_HRK-01       -agc-gcaccatgtggcgg-------cgccgcgc----------g-----
A0A3Q1LXZ6_BBC3-01      -agctgcggcggatggcggacgacctcaacgcgctatacgagcgg-----
A0A4W2EKD9_BBC3-02      -agctgcggcggatggcggacgacctcaacgcgctatacgagcgg-----
A0A4W2EKD9_BBC3-01      -agctgcggcggatggcggacgacctcaacgcgctatacgagcgg-----
A0A3Q1NFP6_PMAIP1-      cagttgaggagaattggagacaaactgaat--------------------
A0A4W2CDL0_PMAIP1-      cagttgaggagaattggagacaaactgaat--------------------
A0A4W2D2G6_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
A0A4W2D2G6_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
A0A3Q1MV27_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
A0A3Q1MV27_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
A0A4W2G3J8_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
A0A3Q1MV27_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
A0A4W2G3J8_BCL2L11      gagctacggcgtatcggagacgagtttaatgcatattacccaagaa----
                         *           *    *                               

A0A4W2EII1_BMF-01       ccagcagaaccgaaatcgcatgtggtggcagatcctcctcttccta----
Q05KI3_BMF-01           ccagcagaaccgaaatcgcatgtggtggcagatcctcctcttccta----
Q05KI3_BMF-02           ccagcagaaccgaaatcgcatgtggtggcagatcctcctcttccta----
A0A4W2INA4_BMF-01       ccagcagaaccgaaatcgcatgtggtggcagatcctcctcttccta----
A0A4W2C9A8_BAD-01       tcgcccg----aagagcgcgggca-cggcaacgcaaatgcgacaaa----
F1MUT9_BAD-01           tcgcccg----aagagcgcgggca-cggcaacgcaaatgcgacaaa----
Q3SYZ0_BAD-01           tcgcccg----aagagcgcgggca-cggcaacggaaatgcgacaaa----
A0A4W2CRW4_HRK-01       -----cg----gagccggagggcgccggcgtccggcgcgctccctaccta
A0A4W2GVZ3_HRK-01       -----cg----gagccggagggcgccggcgcccggcgcgctccctaccta
A0A3Q1LXZ6_BBC3-01      -----cg----gagacaagaggag-cggcagcgacaccgcccctcacc--
A0A4W2EKD9_BBC3-02      -----cg----gagacaagaggag-cggcagcgacaccgcccctcacc--
A0A4W2EKD9_BBC3-01      -----cg----gagacaagaggag-cggcagcgacaccgcccctcacc--
A0A3Q1NFP6_PMAIP1-      ----------------ttc------cggcag-------------------
A0A4W2CDL0_PMAIP1-      ----------------ttc------cggcag-------------------
A0A4W2D2G6_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
A0A4W2D2G6_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
A0A3Q1MV27_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
A0A3Q1MV27_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
A0A4W2G3J8_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
A0A3Q1MV27_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
A0A4W2G3J8_BCL2L11      -----------gggtcttcgtgcgtcaccag-------------------
                                                    *                     

A0A4W2EII1_BMF-01       cacaacgtggctttgaatgg-------agatga-----------------
Q05KI3_BMF-01           cacaacgtggctttgaatgg-------agatga-----------------
Q05KI3_BMF-02           cacaacgtggctttgaatgg-------agatga-----------------
A0A4W2INA4_BMF-01       cacaacgtggctttgaatgg-------agatga-----------------
A0A4W2C9A8_BAD-01       ---gccccagctggacgcgcttcctccag----------------tcctg
F1MUT9_BAD-01           ---gccccagctggacgcgcttcctccag----------------tcctg
Q3SYZ0_BAD-01           ---gccccagctggacgcgcttcctccag----------------tcctg
A0A4W2CRW4_HRK-01       ctggccctggctgtgcgcggccgcg-caggtggcagcg---------ctg
A0A4W2GVZ3_HRK-01       ctggccctggctgtgcgcggccgcg-caggtggcagcg---------ctg
A0A3Q1LXZ6_BBC3-01      ctgg--agggtcctgtacaatctcatcatgggactcctgccctt-tcccg
A0A4W2EKD9_BBC3-02      ctgg--agggtcctgtacaatctcatcatgggactcctgccctt-tcccg
A0A4W2EKD9_BBC3-01      ctgg--agggtcctgtacaatctcatcatgggactcctgccctt-tcccg
A0A3Q1NFP6_PMAIP1-      ------aaacttgtgaatctgatatccaaa-----ctcctccgc-tcagg
A0A4W2CDL0_PMAIP1-      ------aaacttgtgaatctgatatccaaa-----ctcctccgc-tcagg
A0A4W2D2G6_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
A0A4W2D2G6_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
A0A3Q1MV27_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
A0A3Q1MV27_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
A0A4W2G3J8_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
A0A3Q1MV27_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
A0A4W2G3J8_BCL2L11      ------gcagttgagggcc--acccgcaaatggtcctcttgcgcgtcttg
                                                   *                      

A0A4W2EII1_BMF-01       ---gaacaggaacggggcaggc----------------cccaggtga
Q05KI3_BMF-01           ---gaacaggaacggggcaggc----------------cccaggtga
Q05KI3_BMF-02           ---gaacaggaacggggcaggc----------------cccaggtga
A0A4W2INA4_BMF-01       ---gaacaggaacggggcaggc----------------cccaggtga
A0A4W2C9A8_BAD-01       gttgagccggaacttggggagaggaggctccgccccctcccagtga-
F1MUT9_BAD-01           gttgagccggaacttggggagaggaggctccgccccctcccagtga-
Q3SYZ0_BAD-01           gttgagccggaacttggggagaggaggctccgccccctcccagtga-
A0A4W2CRW4_HRK-01       gcggcctggctgctcggcaggcggaa------------cttg--tag
A0A4W2GVZ3_HRK-01       gcggcctggctgctcggcaggcggaa------------cttg--tag
A0A3Q1LXZ6_BBC3-01      ggggccgcggagcccccgaggtggag------------cccaattag
A0A4W2EKD9_BBC3-02      ggggccgcggagcccccgaggtggag------------cccaattag
A0A4W2EKD9_BBC3-01      ggggccgcggagcccccgaggtggag------------cccaattag
A0A3Q1NFP6_PMAIP1-      aact----------------------------------------tga
A0A4W2CDL0_PMAIP1-      aact----------------------------------------tga
A0A4W2D2G6_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
A0A4W2D2G6_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
A0A3Q1MV27_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
A0A3Q1MV27_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
A0A4W2G3J8_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
A0A3Q1MV27_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
A0A4W2G3J8_BCL2L11      cgctacatcgtgcgtctggtgtggagg-----------atgcagtga
                                                                       

© 1998-2021Legal notice