Dataset for CDS BCL2L11 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccagg
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------

A0A4W2D2G6_BCL2L11      ----------------------------------------------atgg
A0A4W2D2G6_BCL2L11      ----------------------------------------------atgg
A0A3Q1MV27_BCL2L11      agccggcttgggggaccttgctcccattcggagaaaaaaagaccaaatgg
A0A3Q1MV27_BCL2L11      ----------------------------------------------atgg
A0A4W2G3J8_BCL2L11      ----------------------------------------------atgg
A0A3Q1MV27_BCL2L11      ----------------------------------------------atgg
A0A4W2G3J8_BCL2L11      ----------------------------------------------atgg

A0A4W2D2G6_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A4W2D2G6_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A3Q1MV27_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A3Q1MV27_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A4W2G3J8_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A3Q1MV27_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa
A0A4W2G3J8_BCL2L11      caaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaa

A0A4W2D2G6_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagaccgggggcccccacctc
A0A4W2D2G6_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagaccgggggcccccacctc
A0A3Q1MV27_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
A0A3Q1MV27_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
A0A4W2G3J8_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
A0A3Q1MV27_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
A0A4W2G3J8_BCL2L11      ttgcagcctgccgagaggcctcctcagctcagacctggggcccccacctc
                        *********************************** **************

A0A4W2D2G6_BCL2L11      tttacagacagagcggca--------------------------------
A0A4W2D2G6_BCL2L11      tttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcc
A0A3Q1MV27_BCL2L11      tttacagacagagcggca--------------------------------
A0A3Q1MV27_BCL2L11      tttacagacagagcggca--------------------------------
A0A4W2G3J8_BCL2L11      tttacagacagagcggca--------------------------------
A0A3Q1MV27_BCL2L11      tttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcc
A0A4W2G3J8_BCL2L11      tttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcc

A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      tccaaggcagcccacagggcccgctggccccaccggccagccctggccct
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      cccaaggcagcccacagggcccgctggccccaccggccagccctggccct
A0A4W2G3J8_BCL2L11      cccaaggcagcccacagggcccgctggccccaccggccagccctggccct

A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      ttcgctaccagatccccgctcttcatcttcgtgagaagatcctccttgct
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      ttcgctaccagatccccgctcttcatcttcgtgagaagatcctccttgct
A0A4W2G3J8_BCL2L11      ttcgctaccagatccccgctcttcatcttcgtgagaagatcctccttgct

A0A4W2D2G6_BCL2L11      ------------------------------------agacaggagcccgg
A0A4W2D2G6_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagacaggagcccgg
A0A3Q1MV27_BCL2L11      ------------------------------------agacaggagcccgg
A0A3Q1MV27_BCL2L11      ------------------------------------agacaggagcccgg
A0A4W2G3J8_BCL2L11      ------------------------------------agacaggagcccgg
A0A3Q1MV27_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagacaggagcccgg
A0A4W2G3J8_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagacaggagcccgg

A0A4W2D2G6_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
A0A4W2D2G6_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
A0A3Q1MV27_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
A0A3Q1MV27_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
A0A4W2G3J8_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
A0A3Q1MV27_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag
A0A4W2G3J8_BCL2L11      cacccatgagttgtgacaaatccacacagaccccaagccctccttgccag

A0A4W2D2G6_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
A0A4W2D2G6_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
A0A3Q1MV27_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
A0A3Q1MV27_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
A0A4W2G3J8_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
A0A3Q1MV27_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc
A0A4W2G3J8_BCL2L11      gccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggc

A0A4W2D2G6_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
A0A4W2D2G6_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
A0A3Q1MV27_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
A0A3Q1MV27_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
A0A4W2G3J8_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
A0A3Q1MV27_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc
A0A4W2G3J8_BCL2L11      tgtacctgcagatacacgcccagagatatggattgcccaagagctacggc

A0A4W2D2G6_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
A0A4W2D2G6_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
A0A3Q1MV27_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
A0A3Q1MV27_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
A0A4W2G3J8_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
A0A3Q1MV27_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt
A0A4W2G3J8_BCL2L11      gtatcggagacgagtttaatgcatattacccaagaagggtcttcgtgcgt

A0A4W2D2G6_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
A0A4W2D2G6_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
A0A3Q1MV27_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
A0A3Q1MV27_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
A0A4W2G3J8_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
A0A3Q1MV27_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg
A0A4W2G3J8_BCL2L11      caccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcg

A0A4W2D2G6_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga
A0A4W2D2G6_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga
A0A3Q1MV27_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga
A0A3Q1MV27_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga
A0A4W2G3J8_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga
A0A3Q1MV27_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga
A0A4W2G3J8_BCL2L11      ctacatcgtgcgtctggtgtggaggatgcagtga

© 1998-2021Legal notice