Dataset for CDS BAD of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1MUT9_BAD-01      atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagatagg
Q3SYZ0_BAD-01      atgttccagatcccagagtttgagcagagtgagcaggaagactccagccgtgcagatagg
                   ************************************************* **********

F1MUT9_BAD-01      ggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaaca
Q3SYZ0_BAD-01      ggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaaca

F1MUT9_BAD-01      gccccaggcctcctgggggaagctggtcaccagcaggggcagccggccggcagcagccac
Q3SYZ0_BAD-01      gccccaggcctcctgggggaagctggtcaccagcaggggcagccggccggcagcagccac

F1MUT9_BAD-01      catggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
Q3SYZ0_BAD-01      catggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca

F1MUT9_BAD-01      gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcg
Q3SYZ0_BAD-01      gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcg

F1MUT9_BAD-01      gcgccccccaacctctgggctgcacagcgatatggccgcgagctccggaggatgagcgac
Q3SYZ0_BAD-01      gcgccccccaacctctgggctgcacagcgatatggccgcgaactccggaggatgagcgac
                   ***************************************** ******************

F1MUT9_BAD-01      gagtttcacgtctccttcaaggggcttcctcgcccgaagagcgcgggcacggcaacgcaa
Q3SYZ0_BAD-01      gagtttcacgtctccttcaaggggcttcctcgcccgaagagcgcgggcacggcaacggaa
                   ********************************************************* **

F1MUT9_BAD-01      atgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
Q3SYZ0_BAD-01      atgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg

F1MUT9_BAD-01      agaggaggctccgccccctcccagtga
Q3SYZ0_BAD-01      agaggaggctccgccccctcccagtga

© 1998-2020Legal notice