Dataset for CDS BAD of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2C9A8_BAD-01      atgttccagatcccagagtttgagcagagtgagcaggaagactccagccc
F1MUT9_BAD-01          atgttccagatcccagagtttgagcagagtgagcaggaagactccagccc
Q3SYZ0_BAD-01          atgttccagatcccagagtttgagcagagtgagcaggaagactccagccg
                       ************************************************* 

A0A4W2C9A8_BAD-01      tgcagataggggcctgggccccagccccacaggggacaggcccccaggtc
F1MUT9_BAD-01          tgcagataggggcctgggccccagccccacaggggacaggcccccaggtc
Q3SYZ0_BAD-01          tgcagataggggcctgggccccagccccacaggggacaggcccccaggtc
                       **************************************************

A0A4W2C9A8_BAD-01      tcagcaagcactggctaacagccccaggcctcctgggggaagctggtcac
F1MUT9_BAD-01          tcagcaagcactggctaacagccccaggcctcctgggggaagctggtcac
Q3SYZ0_BAD-01          tcagcaagcactggctaacagccccaggcctcctgggggaagctggtcac
                       **************************************************

A0A4W2C9A8_BAD-01      cagcaggggcagccggccggcagcagccaccatggaggcactggggctgt
F1MUT9_BAD-01          cagcaggggcagccggccggcagcagccaccatggaggcactggggctgt
Q3SYZ0_BAD-01          cagcaggggcagccggccggcagcagccaccatggaggcactggggctgt
                       **************************************************

A0A4W2C9A8_BAD-01      ggagacccggagtcgtcacagctcctaccgcgcggggccagaggataatg
F1MUT9_BAD-01          ggagacccggagtcgtcacagctcctaccgcgcggggccagaggataatg
Q3SYZ0_BAD-01          ggagacccggagtcgtcacagctcctaccgcgcggggccagaggataatg
                       **************************************************

A0A4W2C9A8_BAD-01      aagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcg
F1MUT9_BAD-01          aagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcg
Q3SYZ0_BAD-01          aagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcg
                       **************************************************

A0A4W2C9A8_BAD-01      gcgccccccaacctctgggctgcacagcgatatggccgcgagctccggag
F1MUT9_BAD-01          gcgccccccaacctctgggctgcacagcgatatggccgcgagctccggag
Q3SYZ0_BAD-01          gcgccccccaacctctgggctgcacagcgatatggccgcgaactccggag
                       ***************************************** ********

A0A4W2C9A8_BAD-01      gatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
F1MUT9_BAD-01          gatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
Q3SYZ0_BAD-01          gatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
                       **************************************************

A0A4W2C9A8_BAD-01      gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttc
F1MUT9_BAD-01          gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttc
Q3SYZ0_BAD-01          gcgcgggcacggcaacggaaatgcgacaaagccccagctggacgcgcttc
                       ***************** ********************************

A0A4W2C9A8_BAD-01      ctccagtcctggttgagccggaacttggggagaggaggctccgccccctc
F1MUT9_BAD-01          ctccagtcctggttgagccggaacttggggagaggaggctccgccccctc
Q3SYZ0_BAD-01          ctccagtcctggttgagccggaacttggggagaggaggctccgccccctc
                       **************************************************

A0A4W2C9A8_BAD-01      ccagtga
F1MUT9_BAD-01          ccagtga
Q3SYZ0_BAD-01          ccagtga
                       *******

© 1998-2022Legal notice