Dataset for CDS classical BH3-containing proteins of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2EII1_BMF-01       atg---------------------gagccaccccagtgtgtggaggagct
A0A4W2INA4_BMF-01       atg---------------------gagccaccccagtgtgtggaggagct
A0A4W2C9A8_BAD-01       atg------------------ttccagatcccagagtttgagcagagt--
A0A4W2CRW4_HRK-01       atg-----------------------------------------------
A0A4W2GVZ3_HRK-01       atg-----------------------------------------------
A0A4W2EKD9_BBC3-01      gtg-----------------------------agagccactgcagaggct
A0A4W2EKD9_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
A0A4W2CDL0_PMAIP1-      at------------------------------------------------
A0A4W2D2G6_BCL2L11      atg------------------------------------gcaaagcaacc
A0A4W2D2G6_BCL2L11      atg------------------------------------gcaaagcaacc
A0A4W2G3J8_BCL2L11      atg------------------------------------gcaaagcaacc
A0A4W2G3J8_BCL2L11      atg------------------------------------gcaaagcaacc
                         *                                                

A0A4W2EII1_BMF-01       ggaggatgacgtattccagcccgaggatggggagccggggacccagcc--
A0A4W2INA4_BMF-01       ggaggatgacgtattccagcccgaggatggggagccggggacccagcc--
A0A4W2C9A8_BAD-01       -gagcaggaag-actccagccctgcagataggggcctgggccccagcccc
A0A4W2CRW4_HRK-01       ----------t-gcccgtgccc------------cctgcaccgcggccgc
A0A4W2GVZ3_HRK-01       ----------t-gcccgtgccc------------cctgcaccgcggccgc
A0A4W2EKD9_BBC3-01      -gcccgggcat-gtccgtgc-----------------------cagctgc
A0A4W2EKD9_BBC3-02      ggcccgcgacg-gcccgcgccc------------cttcccgctcagccgc
A0A4W2CDL0_PMAIP1-      ---------------------------------------------gcctg
A0A4W2D2G6_BCL2L11      ttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
A0A4W2D2G6_BCL2L11      ttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
A0A4W2G3J8_BCL2L11      ttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
A0A4W2G3J8_BCL2L11      ttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
                                                                     **   

A0A4W2EII1_BMF-01       -caggagctt----------------------------------------
A0A4W2INA4_BMF-01       -caggagctt----------------------------------------
A0A4W2C9A8_BAD-01       acaggggaca----------------------------------------
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A4W2EKD9_BBC3-01      ccggggcttt------------------------------------cttc
A0A4W2EKD9_BBC3-02      ctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgc
A0A4W2CDL0_PMAIP1-      gaagga--------------------------------------------
A0A4W2D2G6_BCL2L11      ccgaga--------------------------------------------
A0A4W2D2G6_BCL2L11      ccgaga--------------------------------------------
A0A4W2G3J8_BCL2L11      ccgaga--------------------------------------------
A0A4W2G3J8_BCL2L11      ccgaga--------------------------------------------
                                                                          

A0A4W2EII1_BMF-01       --------------------------------------------------
A0A4W2INA4_BMF-01       --------------------------------------------------
A0A4W2C9A8_BAD-01       --------------------------------------------------
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A4W2EKD9_BBC3-01      tccccct-------------------------------------------
A0A4W2EKD9_BBC3-02      tgcccccgccgcccccgccctgctgcccgccgcctacctctgcgccccca
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W2EII1_BMF-01       ------------------------------gctctctgctgacc------
A0A4W2INA4_BMF-01       ------------------------------gctctctgctgacc------
A0A4W2C9A8_BAD-01       ------------------------------ggcccc--caggtctcagca
A0A4W2CRW4_HRK-01       ------------------------------ggcccc--ccggcc------
A0A4W2GVZ3_HRK-01       ------------------------------ggcccc--ccggcc------
A0A4W2EKD9_BBC3-01      ------------------------------gggtcc--cccacc------
A0A4W2EKD9_BBC3-02      ccgccccgcccgccgtcaccgccgccctgggggccc--cccgct------
A0A4W2CDL0_PMAIP1-      ------------------------------gggctc--------------
A0A4W2D2G6_BCL2L11      ------------------------------ggcctc--------------
A0A4W2D2G6_BCL2L11      ------------------------------ggcctc--------------
A0A4W2G3J8_BCL2L11      ------------------------------ggcctc--------------
A0A4W2G3J8_BCL2L11      ------------------------------ggcctc--------------
                                                      *    *              

A0A4W2EII1_BMF-01       --tgtttg-----cccagagccagctggactgccc------cctcagccg
A0A4W2INA4_BMF-01       --tgtttg-----cccagagccagctggactgccc------cctcagccg
A0A4W2C9A8_BAD-01       agcactgg-----ctaacagcc--ccaggcctcctgggggaagctggtca
A0A4W2CRW4_HRK-01       -gtgtgcg-----cctgcag---------------------cgccggccg
A0A4W2GVZ3_HRK-01       -gtgtgcg-----cctgcag---------------------cgccggccg
A0A4W2EKD9_BBC3-01      -agattcg------------------------------------tggtcc
A0A4W2EKD9_BBC3-02      -ggcctgggggtccccgcagccggccccgaggcccgcgacccgacggtcc
A0A4W2CDL0_PMAIP1-      ------------------------------------------gtaa----
A0A4W2D2G6_BCL2L11      ------------------------------------------ctcagctc
A0A4W2D2G6_BCL2L11      ------------------------------------------ctcagctc
A0A4W2G3J8_BCL2L11      ------------------------------------------ctcagctc
A0A4W2G3J8_BCL2L11      ------------------------------------------ctcagctc
                                                                          

A0A4W2EII1_BMF-01       tctgcagctcttccctctcacgcactgctgtggccctgggcttcgaccca
A0A4W2INA4_BMF-01       tctgcagctcttccctctcacgcactgctgtggccctgggcttcgaccca
A0A4W2C9A8_BAD-01       ccagcaggggcagccggccg---------gcagcagccaccatggaggca
A0A4W2CRW4_HRK-01       cctgggtctgcgctcgtccgccgc-----gcagc-------------tca
A0A4W2GVZ3_HRK-01       cctgggtctgcgctcgtccgccgc-----gcagc-------------tca
A0A4W2EKD9_BBC3-01      tcagccttcactctcgcccgcgga-----gcagca-----cctggaatca
A0A4W2EKD9_BBC3-02      tcagccttcactctcgcccgcgga-----gcagca-----cctggaatca
A0A4W2CDL0_PMAIP1-      -------gagcgcccagcc-------------------------------
A0A4W2D2G6_BCL2L11      agaccgggggcccccacctctttacagacagagcggca------------
A0A4W2D2G6_BCL2L11      agaccgggggcccccacctctttacagacagagcggcaaggtaatcctga
A0A4W2G3J8_BCL2L11      agacctggggcccccacctctttacagacagagcggca------------
A0A4W2G3J8_BCL2L11      agacctggggcccccacctctttacagacagagcggcaaggtaatcctga
                                      *                                   

A0A4W2EII1_BMF-01       ccagccaggaagacaaggctacccagactctcagc----ccagcttcccc
A0A4W2INA4_BMF-01       ccagccaggaagacaaggctacccagactctcagc----ccagcttcccc
A0A4W2C9A8_BAD-01       ctggg------gctgtggagacccggagtcgtcacagctcctaccgcgcg
A0A4W2CRW4_HRK-01       c-----------------------------------g-----gcagcccg
A0A4W2GVZ3_HRK-01       c-----------------------------------g-----gcagcccg
A0A4W2EKD9_BBC3-01      ccagt------gcccagcgccccgggggccctggcgg-----gcggcccc
A0A4W2EKD9_BBC3-02      ccagt------gcccagcgccccgggggccctggcgg-----gcggcccc
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      aggagaaggggaccgctgcctccaaggcagcccacagggcccgctggccc
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      aggagaaggggaccgctgcccccaaggcagcccacagggcccgctggccc
                                                                          

A0A4W2EII1_BMF-01       gagccagggtgtcatgctgccttgtggggtgac-----------------
A0A4W2INA4_BMF-01       gagccagggtgtcatgctgccttgtggggtgac-----------------
A0A4W2C9A8_BAD-01       gggccagaggataatgaagagacggag-----------------------
A0A4W2CRW4_HRK-01       gctcaaggcgctc-----------ggc-----------------------
A0A4W2GVZ3_HRK-01       gctcaaggcgctc-----------ggc-----------------------
A0A4W2EKD9_BBC3-01      acccaagcggccccgggagtccggggg-----------------------
A0A4W2EKD9_BBC3-02      acccaagcggccccgggagtccggggg-----------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      caccggccagccctggccctttcgctaccagatccccgctcttcatcttc
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      caccggccagccctggccctttcgctaccagatccccgctcttcatcttc
                                                                          

A0A4W2EII1_BMF-01       --------------------------------------------------
A0A4W2INA4_BMF-01       --------------------------------------------------
A0A4W2C9A8_BAD-01       --------------------------------------------------
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      gtgagaagatcctccttgctgtctcgatcctccagtgggtatttctcttt
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      gtgagaagatcctccttgctgtctcgatcctccagtgggtatttctcttt
                                                                          

A0A4W2EII1_BMF-01       ------tgaggagccccagcgactcttttatggccatgctggctaccggc
A0A4W2INA4_BMF-01       ------tgaggagccccagcgactcttttatggcaatgctggctaccggc
A0A4W2C9A8_BAD-01       -------gaggaggatctcggcccctttaggggcc--gctcgcgttcggc
A0A4W2CRW4_HRK-01       -------gacgagctgc-----------a---------------------
A0A4W2GVZ3_HRK-01       -------gacgagctgc-----------a---------------------
A0A4W2EKD9_BBC3-01      -------gaggaggagc-----------agtgggc--ccgagagatcggg
A0A4W2EKD9_BBC3-02      -------gaggaggagc-----------agtgggc--ccgagagatcggg
A0A4W2CDL0_PMAIP1-      ------------gagcc------------------------ccacgcggg
A0A4W2D2G6_BCL2L11      ------agacaggagcccggcacccatgagttgtgacaaatccacacaga
A0A4W2D2G6_BCL2L11      tgacacagacaggagcccggcacccatgagttgtgacaaatccacacaga
A0A4W2G3J8_BCL2L11      ------agacaggagcccggcacccatgagttgtgacaaatccacacaga
A0A4W2G3J8_BCL2L11      tgacacagacaggagcccggcacccatgagttgtgacaaatccacacaga
                                    *   *                                 

A0A4W2EII1_BMF-01       tcccccttcctgccagtttccctgcaggcttgccccttggtgagcagccc
A0A4W2INA4_BMF-01       tcccccttcctgccagtttccctgcaggcttgccccttggtgagcagccc
A0A4W2C9A8_BAD-01       gccccccaacctc-------------------------------------
A0A4W2CRW4_HRK-01       --cc----------------------------------------------
A0A4W2GVZ3_HRK-01       --cc----------------------------------------------
A0A4W2EKD9_BBC3-01      gccc----------------------------------------------
A0A4W2EKD9_BBC3-02      gccc----------------------------------------------
A0A4W2CDL0_PMAIP1-      tccc----------------------------------------------
A0A4W2D2G6_BCL2L11      ccccaagccctccttgccaggccttcaaccattatctcagtgcaatggct
A0A4W2D2G6_BCL2L11      ccccaagccctccttgccaggccttcaaccattatctcagtgcaatggct
A0A4W2G3J8_BCL2L11      ccccaagccctccttgccaggccttcaaccattatctcagtgcaatggct
A0A4W2G3J8_BCL2L11      ccccaagccctccttgccaggccttcaaccattatctcagtgcaatggct
                          **                                              

A0A4W2EII1_BMF-01       cctgaagggcagtggcaacatcgagcagagatacagat------------
A0A4W2INA4_BMF-01       cctgaagggcagtggcaacatcgagcagagatacagat------------
A0A4W2C9A8_BAD-01       ---------------------tgggctgcacagcgata------------
A0A4W2CRW4_HRK-01       --------------------------------------------------
A0A4W2GVZ3_HRK-01       --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      -----------------ggcagatcctgaagttgaatg------------
A0A4W2D2G6_BCL2L11      tccatgaggcagtctcaggctgtacctgcagatacacgcccagagatatg
A0A4W2D2G6_BCL2L11      tccatgaggcagtctcaggctgtacctgcagatacacgcccagagatatg
A0A4W2G3J8_BCL2L11      tccatgaggcagtctcaggctgtacctgcagatacacgcccagagatatg
A0A4W2G3J8_BCL2L11      tccatgaggcagtctcaggctgtacctgcagatacacgcccagagatatg
                                                                          

A0A4W2EII1_BMF-01       ---tgcccgaaaactccagtgcattgcagaccagttccatcggcttcata
A0A4W2INA4_BMF-01       ---tgcccgaaaactccagtgcattgcagaccagttccatcggcttcata
A0A4W2C9A8_BAD-01       ---tggccgcgagctccggaggatgagcgacgagtttcacgtctccttca
A0A4W2CRW4_HRK-01       -----------agc-gcaccatgtggcgg-------cgccgcgc------
A0A4W2GVZ3_HRK-01       -----------agc-gcaccatgtggcgg-------cgccgcgc------
A0A4W2EKD9_BBC3-01      -----------agctgcggcggatggcggacgacctcaacgcgctatacg
A0A4W2EKD9_BBC3-02      -----------agctgcggcggatggcggacgacctcaacgcgctatacg
A0A4W2CDL0_PMAIP1-      ---tgccattcagttgaggagaattggagacaaactgaat----------
A0A4W2D2G6_BCL2L11      gattgcccaagagctacggcgtatcggagacgagtttaatgcatattacc
A0A4W2D2G6_BCL2L11      gattgcccaagagctacggcgtatcggagacgagtttaatgcatattacc
A0A4W2G3J8_BCL2L11      gattgcccaagagctacggcgtatcggagacgagtttaatgcatattacc
A0A4W2G3J8_BCL2L11      gattgcccaagagctacggcgtatcggagacgagtttaatgcatattacc
                                   *           *    *                     

A0A4W2EII1_BMF-01       tgcagcaataccagcagaaccgaaatcgcatgtggtggcagatcctcctc
A0A4W2INA4_BMF-01       tgcagcaataccagcagaaccgaaatcgcatgtggtggcagatcctcctc
A0A4W2C9A8_BAD-01       aggggcttcctcgcccg----aagagcgcgggca-cggcaacgcaaatgc
A0A4W2CRW4_HRK-01       ----g----------cg----gagccggagggcgccggcgtccggcgcgc
A0A4W2GVZ3_HRK-01       ----g----------cg----gagccggagggcgccggcgcccggcgcgc
A0A4W2EKD9_BBC3-01      agcgg----------cg----gagacaagaggag-cggcagcgacaccgc
A0A4W2EKD9_BBC3-02      agcgg----------cg----gagacaagaggag-cggcagcgacaccgc
A0A4W2CDL0_PMAIP1-      --------------------------ttc------cggcag---------
A0A4W2D2G6_BCL2L11      caagaa---------------gggtcttcgtgcgtcaccag---------
A0A4W2D2G6_BCL2L11      caagaa---------------gggtcttcgtgcgtcaccag---------
A0A4W2G3J8_BCL2L11      caagaa---------------gggtcttcgtgcgtcaccag---------
A0A4W2G3J8_BCL2L11      caagaa---------------gggtcttcgtgcgtcaccag---------
                                                              *           

A0A4W2EII1_BMF-01       ttccta----cacaacgtggctttgaatgg-------agatga-------
A0A4W2INA4_BMF-01       ttccta----cacaacgtggctttgaatgg-------agatga-------
A0A4W2C9A8_BAD-01       gacaaa-------gccccagctggacgcgcttcctccag-----------
A0A4W2CRW4_HRK-01       tccctacctactggccctggctgtgcgcggccgcg-caggtggcagcg--
A0A4W2GVZ3_HRK-01       tccctacctactggccctggctgtgcgcggccgcg-caggtggcagcg--
A0A4W2EKD9_BBC3-01      ccctcacc--ctgg--agggtcctgtacaatctcatcatgggactcctgc
A0A4W2EKD9_BBC3-02      ccctcacc--ctgg--agggtcctgtacaatctcatcatgggactcctgc
A0A4W2CDL0_PMAIP1-      ----------------aaacttgtgaatctgatatccaaa-----ctcct
A0A4W2D2G6_BCL2L11      ----------------gcagttgagggcc--acccgcaaatggtcctctt
A0A4W2D2G6_BCL2L11      ----------------gcagttgagggcc--acccgcaaatggtcctctt
A0A4W2G3J8_BCL2L11      ----------------gcagttgagggcc--acccgcaaatggtcctctt
A0A4W2G3J8_BCL2L11      ----------------gcagttgagggcc--acccgcaaatggtcctctt
                                                             *            

A0A4W2EII1_BMF-01       -------------gaacaggaacggggcaggc----------------cc
A0A4W2INA4_BMF-01       -------------gaacaggaacggggcaggc----------------cc
A0A4W2C9A8_BAD-01       -----tcctggttgagccggaacttggggagaggaggctccgccccctcc
A0A4W2CRW4_HRK-01       -------ctggcggcctggctgctcggcaggcggaa------------ct
A0A4W2GVZ3_HRK-01       -------ctggcggcctggctgctcggcaggcggaa------------ct
A0A4W2EKD9_BBC3-01      cctt-tcccgggggccgcggagcccccgaggtggag------------cc
A0A4W2EKD9_BBC3-02      cctt-tcccgggggccgcggagcccccgaggtggag------------cc
A0A4W2CDL0_PMAIP1-      ccgc-tcaggaact------------------------------------
A0A4W2D2G6_BCL2L11      gcgcgtcttgcgctacatcgtgcgtctggtgtggagg-----------at
A0A4W2D2G6_BCL2L11      gcgcgtcttgcgctacatcgtgcgtctggtgtggagg-----------at
A0A4W2G3J8_BCL2L11      gcgcgtcttgcgctacatcgtgcgtctggtgtggagg-----------at
A0A4W2G3J8_BCL2L11      gcgcgtcttgcgctacatcgtgcgtctggtgtggagg-----------at
                                                                          

A0A4W2EII1_BMF-01       caggtga
A0A4W2INA4_BMF-01       caggtga
A0A4W2C9A8_BAD-01       cagtga-
A0A4W2CRW4_HRK-01       tg--tag
A0A4W2GVZ3_HRK-01       tg--tag
A0A4W2EKD9_BBC3-01      caattag
A0A4W2EKD9_BBC3-02      caattag
A0A4W2CDL0_PMAIP1-      ----tga
A0A4W2D2G6_BCL2L11      gcagtga
A0A4W2D2G6_BCL2L11      gcagtga
A0A4W2G3J8_BCL2L11      gcagtga
A0A4W2G3J8_BCL2L11      gcagtga
                               

© 1998-2020Legal notice