Dataset for CDS BMF of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2EII1_BMF-01      atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcc
A0A4W2INA4_BMF-01      atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcc

A0A4W2EII1_BMF-01      cgaggatggggagccggggacccagcccaggagcttgctctctgctgacc
A0A4W2INA4_BMF-01      cgaggatggggagccggggacccagcccaggagcttgctctctgctgacc

A0A4W2EII1_BMF-01      tgtttgcccagagccagctggactgccccctcagccgtctgcagctcttc
A0A4W2INA4_BMF-01      tgtttgcccagagccagctggactgccccctcagccgtctgcagctcttc

A0A4W2EII1_BMF-01      cctctcacgcactgctgtggccctgggcttcgacccaccagccaggaaga
A0A4W2INA4_BMF-01      cctctcacgcactgctgtggccctgggcttcgacccaccagccaggaaga

A0A4W2EII1_BMF-01      caaggctacccagactctcagcccagcttccccgagccagggtgtcatgc
A0A4W2INA4_BMF-01      caaggctacccagactctcagcccagcttccccgagccagggtgtcatgc

A0A4W2EII1_BMF-01      tgccttgtggggtgactgaggagccccagcgactcttttatggccatgct
A0A4W2INA4_BMF-01      tgccttgtggggtgactgaggagccccagcgactcttttatggcaatgct
                       ******************************************** *****

A0A4W2EII1_BMF-01      ggctaccggctcccccttcctgccagtttccctgcaggcttgccccttgg
A0A4W2INA4_BMF-01      ggctaccggctcccccttcctgccagtttccctgcaggcttgccccttgg

A0A4W2EII1_BMF-01      tgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
A0A4W2INA4_BMF-01      tgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg

A0A4W2EII1_BMF-01      cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcag
A0A4W2INA4_BMF-01      cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcag

A0A4W2EII1_BMF-01      caataccagcagaaccgaaatcgcatgtggtggcagatcctcctcttcct
A0A4W2INA4_BMF-01      caataccagcagaaccgaaatcgcatgtggtggcagatcctcctcttcct

A0A4W2EII1_BMF-01      acacaacgtggctttgaatggagatgagaacaggaacggggcaggcccca
A0A4W2INA4_BMF-01      acacaacgtggctttgaatggagatgagaacaggaacggggcaggcccca

A0A4W2EII1_BMF-01      ggtga
A0A4W2INA4_BMF-01      ggtga

© 1998-2022Legal notice