Dataset for CDS BCL2L11 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2D2G6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A4W2D2G6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A4W2G3J8_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A4W2G3J8_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A4W2D2G6_BCL2L11      acaattgcagcctgccgagaggcctcctcagctcagaccgggggccccca
A0A4W2D2G6_BCL2L11      acaattgcagcctgccgagaggcctcctcagctcagaccgggggccccca
A0A4W2G3J8_BCL2L11      acaattgcagcctgccgagaggcctcctcagctcagacctggggccccca
A0A4W2G3J8_BCL2L11      acaattgcagcctgccgagaggcctcctcagctcagacctggggccccca
                        *************************************** **********

A0A4W2D2G6_BCL2L11      cctctttacagacagagcggca----------------------------
A0A4W2D2G6_BCL2L11      cctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgc
A0A4W2G3J8_BCL2L11      cctctttacagacagagcggca----------------------------
A0A4W2G3J8_BCL2L11      cctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgc
                        **********************                            

A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      tgcctccaaggcagcccacagggcccgctggccccaccggccagccctgg
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      tgcccccaaggcagcccacagggcccgctggccccaccggccagccctgg
                                                                          

A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      ccctttcgctaccagatccccgctcttcatcttcgtgagaagatcctcct
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      ccctttcgctaccagatccccgctcttcatcttcgtgagaagatcctcct
                                                                          

A0A4W2D2G6_BCL2L11      ----------------------------------------agacaggagc
A0A4W2D2G6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A4W2G3J8_BCL2L11      ----------------------------------------agacaggagc
A0A4W2G3J8_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
                                                                **********

A0A4W2D2G6_BCL2L11      ccggcacccatgagttgtgacaaatccacacagaccccaagccctccttg
A0A4W2D2G6_BCL2L11      ccggcacccatgagttgtgacaaatccacacagaccccaagccctccttg
A0A4W2G3J8_BCL2L11      ccggcacccatgagttgtgacaaatccacacagaccccaagccctccttg
A0A4W2G3J8_BCL2L11      ccggcacccatgagttgtgacaaatccacacagaccccaagccctccttg
                        **************************************************

A0A4W2D2G6_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A4W2D2G6_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A4W2G3J8_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A4W2G3J8_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
                        **************************************************

A0A4W2D2G6_BCL2L11      aggctgtacctgcagatacacgcccagagatatggattgcccaagagcta
A0A4W2D2G6_BCL2L11      aggctgtacctgcagatacacgcccagagatatggattgcccaagagcta
A0A4W2G3J8_BCL2L11      aggctgtacctgcagatacacgcccagagatatggattgcccaagagcta
A0A4W2G3J8_BCL2L11      aggctgtacctgcagatacacgcccagagatatggattgcccaagagcta
                        **************************************************

A0A4W2D2G6_BCL2L11      cggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcgt
A0A4W2D2G6_BCL2L11      cggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcgt
A0A4W2G3J8_BCL2L11      cggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcgt
A0A4W2G3J8_BCL2L11      cggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcgt
                        **************************************************

A0A4W2D2G6_BCL2L11      gcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtct
A0A4W2D2G6_BCL2L11      gcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtct
A0A4W2G3J8_BCL2L11      gcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtct
A0A4W2G3J8_BCL2L11      gcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtct
                        **************************************************

A0A4W2D2G6_BCL2L11      tgcgctacatcgtgcgtctggtgtggaggatgcagtga
A0A4W2D2G6_BCL2L11      tgcgctacatcgtgcgtctggtgtggaggatgcagtga
A0A4W2G3J8_BCL2L11      tgcgctacatcgtgcgtctggtgtggaggatgcagtga
A0A4W2G3J8_BCL2L11      tgcgctacatcgtgcgtctggtgtggaggatgcagtga
                        **************************************

© 1998-2020Legal notice