Dataset for CDS BBC3 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2EKD9_BBC3-01      gtg-----------------------------agagccactgcagaggct
A0A4W2EKD9_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
                         **                              *****  *  ** * **

A0A4W2EKD9_BBC3-01      -gcccgggcatgtccgtgc-----------cagctgcccggggcttt---
A0A4W2EKD9_BBC3-02      ggcccgcgacggcccgcgccccttcccgctcagccgcctggtgccctcgg
                         ***** *   * *** **           **** *** ** **  *   

A0A4W2EKD9_BBC3-01      ---------------------------------cttctccccct------
A0A4W2EKD9_BBC3-02      cggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcc
                                                         ** ** ****       

A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      cccgccctgctgcccgccgcctacctctgcgcccccaccgccccgcccgc

A0A4W2EKD9_BBC3-01      -----------------gggtcccccaccagattcg--------------
A0A4W2EKD9_BBC3-02      cgtcaccgccgccctgggggccccccgctggcctgggggtccccgcagcc
                                         *** ***** *  *  * *              

A0A4W2EKD9_BBC3-01      ----------------------tggtcctcagccttcactctcgcccgcg
A0A4W2EKD9_BBC3-02      ggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcg

A0A4W2EKD9_BBC3-01      gagcagcacctggaatcaccagtgcccagcgccccgggggccctggcggg
A0A4W2EKD9_BBC3-02      gagcagcacctggaatcaccagtgcccagcgccccgggggccctggcggg

A0A4W2EKD9_BBC3-01      cggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
A0A4W2EKD9_BBC3-02      cggccccacccaagcggccccgggagtccggggggaggaggagcagtggg

A0A4W2EKD9_BBC3-01      cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A4W2EKD9_BBC3-02      cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcg

A0A4W2EKD9_BBC3-01      ctatacgagcggcggagacaagaggagcggcagcgacaccgcccctcacc
A0A4W2EKD9_BBC3-02      ctatacgagcggcggagacaagaggagcggcagcgacaccgcccctcacc

A0A4W2EKD9_BBC3-01      ctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggg
A0A4W2EKD9_BBC3-02      ctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggg

A0A4W2EKD9_BBC3-01      gccgcggagcccccgaggtggagcccaattag
A0A4W2EKD9_BBC3-02      gccgcggagcccccgaggtggagcccaattag

© 1998-2022Legal notice