Dataset for CDS BAD of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1K1C7_BAD-01      atggcagcaagattcaccatttcagacagcgactcagacccatcagaggg
A0A3Q1K1C7_BAD-02      atggcagcaagattcaccatttcagacagcgactcagacccatcagaggg

A0A3Q1K1C7_BAD-01      gatggaggaagaaggacacaaccagtcaccaccagggcaagagcagcaag
A0A3Q1K1C7_BAD-02      gatggaggaagaaggacacaaccagtcaccaccagggcaagagcagcaag

A0A3Q1K1C7_BAD-01      tttttccacgccacacccttaccttaccggaactcagagctagtggtcga
A0A3Q1K1C7_BAD-02      tttttccacgccacacccttaccttaccggaactcagagctagtggtcga

A0A3Q1K1C7_BAD-01      atcaggctgaactcagagtctcacgcttccaccgtctacagagacgaaga
A0A3Q1K1C7_BAD-02      atcaggctgaactcagagtctcacgcttccaccgtctacagagacgaaga

A0A3Q1K1C7_BAD-01      actccaggccaaggcagatgaggaagctggtacgcccacagatggagctc
A0A3Q1K1C7_BAD-02      actccaggccaaggcagatgaggaagctggtacgcccacagatggagctc

A0A3Q1K1C7_BAD-01      cattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaag
A0A3Q1K1C7_BAD-02      cattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaag

A0A3Q1K1C7_BAD-01      aaatacggccagcagctcagaagaatgagtgacgagtttgacagcctgct
A0A3Q1K1C7_BAD-02      aaatacggccagcagctcagaagaatgagtgacgagtttgacagcctgct

A0A3Q1K1C7_BAD-01      agacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
A0A3Q1K1C7_BAD-02      agacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga

A0A3Q1K1C7_BAD-01      tgcaccactctaagagctggtggagctacctctttagtcaccaggagact
A0A3Q1K1C7_BAD-02      tgcaccactctaagagctggtggagctacctctttagtcaccaggagact

A0A3Q1K1C7_BAD-01      gagggagagaacaatcaccacgaaagccacacacaccgcactgagtag
A0A3Q1K1C7_BAD-02      gagggagagaacaatcaccacgaaagccacacacaccgcactgagtag

© 1998-2020Legal notice