Dataset for CDS adenoviridae of organism Human adenovirus F serotype 41

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A1S6ELT2_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=513 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatatttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggctctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggagagggagaacctg
agggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A3G4W995_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=501 residues).
atggagttttggagtgagctgcaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggagaacctgagggccggtctg
gatcctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A3G8W407_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=498 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggagaacctgagggccggtctggat
cctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A482EVC6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=513 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcaatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggaggagaacctg
agggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A482EVC6_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=1419 residues).
atggagcgcccaaacccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcgga
ggaagagggtcttaggttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggag
gaggaggagaacctgagggccggtctggatcctcaaacggaattgtaactgaacctgaccccgaagagggtactagcagt
gggcaaaggggggagaaaaggaagttagaaaatgacggggcggattttctaaaggagttaaccttgagtttaatgtctcg
ttgttatcctgagtctgtctggtgggctgatttggaagatgagtttaaaaatggaaacatgaatcttttatacaagtatg
gatttgaacagctgaaaacacattggatggagccttgggaggactgggaactagctttgaatatgtttgccaaagtggct
cttcgcccagacactatttataccattaagaaaactgttaatatacgtaaatgtgcctatgtaattggaaatggagccgt
ggttagattccaaacctttgaccgggtggtttttaactgtgcaatgcagagtttaggtcctggggtgattggtatgagcg
gggtaacatttaataatgtcagatttgcagcagatggatttaatggcaaggtgtttgcttctaccactcaattaactttg
catggtgtgttttttcaaaattgcagcggtgtttgcgtggattcctggggtagggtgtctgccagaggttgtacgtttgt
gggatgttggaaagggctggtggggcaaaacaagagccaaatgtctgtaaaaaaatgtgtgtttgaacgatgcattttgg
ctatggtggtagaaggccaggcgcgaattcgacataatgcgggttccgaaaatgtgtgctttttactgctgaagggaact
gccagtgttaagcataatatgatttgtggcactggtcactctcagctgctaacttgcgcagatggaaactgtcagactct
aaaagtgattcatgtggtttcccatcagcgccgcccctggcctgtttttgagcataacatgcttatgcgttgtaccatgc
atttgggggctcgtcgtggcatgttttctccatatcagagtaatttttgccatactaaagttttaatggaaactgatgct
ttttcgcgggtgtggtggagcggggtgtttgatttgaccatagagctgtataaagtggtgagatatgatgagttaaaggc
tcgttgtcgcccctgtgagtgtggagccaatcacatcaggttatatccagcaactctgaacgtgacggagcagctgcgca
cggaccatcagatgttgtcgtgtcttcgcaccgactacgaatccagcgatgaggattaa
>gnl|bcl2dbcds|A0A7U3RWV6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=477 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctggggtgggtcttatctggtgcgtatgtattcaagagagcgcctatac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatcccacagtgcgggaggaggaggaggagggggaggagaactag
>gnl|bcl2dbcds|A0A898KBR0_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=504 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggagaacctgagggccggt
ctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A898KBS1_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=510 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggagaacctgagg
gccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A898KBW7_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=519 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtgcggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggaggaggaggag
aacctgagggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|B5SNR1_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=513 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggagggatatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggaggagaacctg
agggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|F4ZCJ8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=516 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggaggaggagaac
ctgagggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|P10544_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=507 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggagggatatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggagaacctgagggcc
ggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|W0S1G8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=507 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggagaacctgagggcc
ggtctggatcctcaaacggaattgtaa
© 1998-2022Legal notice