Dataset for CDS adenoviridae of organism Human adenovirus F serotype 41

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1S6ELT2_E1B19K-      atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
A0A3G4W995_E1B19K-      atggagttttggagtgagctgcaaagttatcagagcctccgacgcttgct
A0A3G8W407_E1B19K-      atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
F4ZCJ8_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
B5SNR1_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
P10544_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
A0A482EVC6_E1B19K-      atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
W0S1G8_E1B19K-01        atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
                        ******************** *****************************

A0A1S6ELT2_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
A0A3G4W995_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
A0A3G8W407_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
F4ZCJ8_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
B5SNR1_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
P10544_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
A0A482EVC6_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
W0S1G8_E1B19K-01        ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
                        **************************************************

A0A1S6ELT2_E1B19K-      caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
A0A3G4W995_E1B19K-      caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
A0A3G8W407_E1B19K-      caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
F4ZCJ8_E1B19K-01        caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
B5SNR1_E1B19K-01        caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
P10544_E1B19K-01        caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
A0A482EVC6_E1B19K-      caaccttaactaatgtaatttatagagctaaagaggactactcttcgcaa
W0S1G8_E1B19K-01        caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
                        **************************** ******************* *

A0A1S6ELT2_E1B19K-      tttgctgagcttttgtcttttaaccctggaatatttgcatctttaaattt
A0A3G4W995_E1B19K-      tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
A0A3G8W407_E1B19K-      tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
F4ZCJ8_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
B5SNR1_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
P10544_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
A0A482EVC6_E1B19K-      tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
W0S1G8_E1B19K-01        tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
                        ******************************** *****************

A0A1S6ELT2_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
A0A3G4W995_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
A0A3G8W407_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
F4ZCJ8_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
B5SNR1_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
P10544_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
A0A482EVC6_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
W0S1G8_E1B19K-01        gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
                        **************************************************

A0A1S6ELT2_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
A0A3G4W995_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
A0A3G8W407_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
F4ZCJ8_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
B5SNR1_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
P10544_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
A0A482EVC6_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
W0S1G8_E1B19K-01        cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
                        **************************************************

A0A1S6ELT2_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
A0A3G4W995_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
A0A3G8W407_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
F4ZCJ8_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
B5SNR1_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggagggatatactctggatta
P10544_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggagggatatactctggatta
A0A482EVC6_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
W0S1G8_E1B19K-01        gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
                        *********************************** **************

A0A1S6ELT2_E1B19K-      catgacaatggctctgtggagaaccctgctgcggaggaagagggtcttag
A0A3G4W995_E1B19K-      catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
A0A3G8W407_E1B19K-      catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
F4ZCJ8_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
B5SNR1_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
P10544_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
A0A482EVC6_E1B19K-      catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
W0S1G8_E1B19K-01        catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
                        ************ *************************************

A0A1S6ELT2_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcg---ggag
A0A3G4W995_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcg-------
A0A3G8W407_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcg-------
F4ZCJ8_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggag
B5SNR1_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcg---ggag
P10544_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcg-------
A0A482EVC6_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcg---ggag
W0S1G8_E1B19K-01        gttgctcgccggcgcagcctccgcacggtctggatccagtgcg-------
                        *******************************************       

A0A1S6ELT2_E1B19K-      gaggaggaggaggaggaggagagggagaacctgagggccggtctggatcc
A0A3G4W995_E1B19K-      --------ggaggaggaggaggaggagaacctgagggccggtctggatcc
A0A3G8W407_E1B19K-      -----------ggaggaggaggaggagaacctgagggccggtctggatcc
F4ZCJ8_E1B19K-01        gaggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
B5SNR1_E1B19K-01        gaggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
P10544_E1B19K-01        --ggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
A0A482EVC6_E1B19K-      gaggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
W0S1G8_E1B19K-01        --ggaggaggaggaggaggaggaggagaacctgagggccggtctggatcc
                                   **********  ***************************

A0A1S6ELT2_E1B19K-      tcaaacggaattgtaa
A0A3G4W995_E1B19K-      tcaaacggaattgtaa
A0A3G8W407_E1B19K-      tcaaacggaattgtaa
F4ZCJ8_E1B19K-01        tcaaacggaattgtaa
B5SNR1_E1B19K-01        tcaaacggaattgtaa
P10544_E1B19K-01        tcaaacggaattgtaa
A0A482EVC6_E1B19K-      tcaaacggaattgtaa
W0S1G8_E1B19K-01        tcaaacggaattgtaa
                        ****************

© 1998-2020Legal notice