Dataset for CDS adenoviridae of organism Human adenovirus F serotype 41

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A482EVC6_E1B19K-      atggagcgcccaaacccatctgtcggaggggtatactctggattacatga
A0A7U3RWV6_E1B19K-      atggag--------------ttttggag----------tgagctaca---
A0A1S6ELT2_E1B19K-      atggag--------------ttttggag----------tgagctaca---
B5SNR1_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
P10544_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
A0A482EVC6_E1B19K-      atggag--------------ttttggag----------tgagctaca---
A0A898KBR0_E1B19K-      atggag--------------ttttggag----------tgagctaca---
A0A898KBS1_E1B19K-      atggag--------------ttttggag----------tgagctaca---
W0S1G8_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
A0A3G4W995_E1B19K-      atggag--------------ttttggag----------tgagctgca---
A0A898KBW7_E1B19K-      atggag--------------ttttggag----------tgagctaca---
A0A3G8W407_E1B19K-      atggag--------------ttttggag----------tgagctaca---
F4ZCJ8_E1B19K-01        atggag--------------ttttggag----------tgagctaca---
                        ******              * * ****          **   * **   

A0A482EVC6_E1B19K-      caatggccctgtggagaaccctgctgcggaggaagagggtcttaggttgc
A0A7U3RWV6_E1B19K-      -----------------------------------aagttatcag-----
A0A1S6ELT2_E1B19K-      -----------------------------------aagttatcag-----
B5SNR1_E1B19K-01        -----------------------------------aagttatcag-----
P10544_E1B19K-01        -----------------------------------aagttatcag-----
A0A482EVC6_E1B19K-      -----------------------------------aagttatcag-----
A0A898KBR0_E1B19K-      -----------------------------------aagttatcag-----
A0A898KBS1_E1B19K-      -----------------------------------aagttatcag-----
W0S1G8_E1B19K-01        -----------------------------------aagttatcag-----
A0A3G4W995_E1B19K-      -----------------------------------aagttatcag-----
A0A898KBW7_E1B19K-      -----------------------------------aagttatcag-----
A0A3G8W407_E1B19K-      -----------------------------------aagttatcag-----
F4ZCJ8_E1B19K-01        -----------------------------------aagttatcag-----
                                                           * * * * **     

A0A482EVC6_E1B19K-      tcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggagga
A0A7U3RWV6_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A1S6ELT2_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
B5SNR1_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
P10544_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
A0A482EVC6_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A898KBR0_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A898KBS1_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
W0S1G8_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
A0A3G4W995_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A898KBW7_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
A0A3G8W407_E1B19K-      ----------agcctccg-acgct----------tgctggagttgg----
F4ZCJ8_E1B19K-01        ----------agcctccg-acgct----------tgctggagttgg----
                                  ******** *** *          *** ****  **    

A0A482EVC6_E1B19K-      ggaggaggaggaggaggagaacctgagggccggtctggatcctcaaacgg
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
                                                                          

A0A482EVC6_E1B19K-      aattgtaactgaacctgaccccgaagagggtactagcagtgggcaaaggg
A0A7U3RWV6_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A1S6ELT2_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
B5SNR1_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
P10544_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
A0A482EVC6_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A898KBR0_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A898KBS1_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
W0S1G8_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
A0A3G4W995_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A898KBW7_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
A0A3G8W407_E1B19K-      -cttctgccagaactt----------------ccagctgttg--------
F4ZCJ8_E1B19K-01        -cttctgccagaactt----------------ccagctgttg--------
                          ** *  * **** *                * *** ** *        

A0A482EVC6_E1B19K-      gggagaaaaggaagttagaaaatgacggggcggattttctaaaggagtta
A0A7U3RWV6_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A1S6ELT2_E1B19K-      --------------------------gaggtttattttt-----ggttca
B5SNR1_E1B19K-01        --------------------------gaggtttattttt-----ggttca
P10544_E1B19K-01        --------------------------gaggtttattttt-----ggttca
A0A482EVC6_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A898KBR0_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A898KBS1_E1B19K-      --------------------------gaggtttattttt-----ggttca
W0S1G8_E1B19K-01        --------------------------gaggtttattttt-----ggttca
A0A3G4W995_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A898KBW7_E1B19K-      --------------------------gaggtttattttt-----ggttca
A0A3G8W407_E1B19K-      --------------------------gaggtttattttt-----ggttca
F4ZCJ8_E1B19K-01        --------------------------gaggtttattttt-----ggttca
                                                  * **   *****      *  * *

A0A482EVC6_E1B19K-      accttgagtttaatgtctcgttgttatcctgagtctgtctggtgggctga
A0A7U3RWV6_E1B19K-      accttaa--ctaatgt----------------------------------
A0A1S6ELT2_E1B19K-      accttaa--ctaatgt----------------------------------
B5SNR1_E1B19K-01        accttaa--ctaatgt----------------------------------
P10544_E1B19K-01        accttaa--ctaatgt----------------------------------
A0A482EVC6_E1B19K-      accttaa--ctaatgt----------------------------------
A0A898KBR0_E1B19K-      accttaa--ctaatgt----------------------------------
A0A898KBS1_E1B19K-      accttaa--ctaatgt----------------------------------
W0S1G8_E1B19K-01        accttaa--ctaatgt----------------------------------
A0A3G4W995_E1B19K-      accttaa--ctaatgt----------------------------------
A0A898KBW7_E1B19K-      accttaa--ctaatgt----------------------------------
A0A3G8W407_E1B19K-      accttaa--ctaatgt----------------------------------
F4ZCJ8_E1B19K-01        accttaa--ctaatgt----------------------------------
                        ***** *   ******                                  

A0A482EVC6_E1B19K-      tttggaagatgagtttaaaaatggaaacatgaatcttttatacaagtatg
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
                                                                          

A0A482EVC6_E1B19K-      gatttgaacagctgaaaacacattggatggagccttgggaggactgggaa
A0A7U3RWV6_E1B19K-      aatttatagagctaaa----------------------gaggact-----
A0A1S6ELT2_E1B19K-      aatttatagagccaaa----------------------gaggact-----
B5SNR1_E1B19K-01        aatttatagagctaaa----------------------gaggact-----
P10544_E1B19K-01        aatttatagagctaaa----------------------gaggact-----
A0A482EVC6_E1B19K-      aatttatagagctaaa----------------------gaggact-----
A0A898KBR0_E1B19K-      aatttatagagctaaa----------------------gaggact-----
A0A898KBS1_E1B19K-      aatttatagagctaaa----------------------gaggact-----
W0S1G8_E1B19K-01        aatttatagagctaaa----------------------gaggact-----
A0A3G4W995_E1B19K-      aatttatagagccaaa----------------------gaggact-----
A0A898KBW7_E1B19K-      aatttatagagccaaa----------------------gaggact-----
A0A3G8W407_E1B19K-      aatttatagagccaaa----------------------gaggact-----
F4ZCJ8_E1B19K-01        aatttatagagccaaa----------------------gaggact-----
                         ****  * ***  **                      *******     

A0A482EVC6_E1B19K-      ctagctttgaatatgtttgccaaagtggctcttcgcccagacactattta
A0A7U3RWV6_E1B19K-      ---------------------------actcttcgc--------------
A0A1S6ELT2_E1B19K-      ---------------------------actcttcgc--------------
B5SNR1_E1B19K-01        ---------------------------actcttcgc--------------
P10544_E1B19K-01        ---------------------------actcttcgc--------------
A0A482EVC6_E1B19K-      ---------------------------actcttcgc--------------
A0A898KBR0_E1B19K-      ---------------------------actcttcgc--------------
A0A898KBS1_E1B19K-      ---------------------------actcttcgc--------------
W0S1G8_E1B19K-01        ---------------------------actcttcgc--------------
A0A3G4W995_E1B19K-      ---------------------------actcttcgc--------------
A0A898KBW7_E1B19K-      ---------------------------actcttcgc--------------
A0A3G8W407_E1B19K-      ---------------------------actcttcgc--------------
F4ZCJ8_E1B19K-01        ---------------------------actcttcgc--------------
                                                    ********              

A0A482EVC6_E1B19K-      taccattaagaaaactgttaatatacgtaaatgtgcctatgtaattggaa
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
                                                                          

A0A482EVC6_E1B19K-      atggagccgtggttagatt--ccaaacctttgaccgggtggtttttaact
A0A7U3RWV6_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
A0A1S6ELT2_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
B5SNR1_E1B19K-01        ---------------gatttgctgagcttttgtc--------ttttaac-
P10544_E1B19K-01        ---------------gatttgctgagcttttgtc--------ttttaac-
A0A482EVC6_E1B19K-      ---------------aatttgctgagcttttgtc--------ttttaac-
A0A898KBR0_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
A0A898KBS1_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
W0S1G8_E1B19K-01        ---------------gatttgctgagcttttgtc--------ttttaac-
A0A3G4W995_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
A0A898KBW7_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
A0A3G8W407_E1B19K-      ---------------gatttgctgagcttttgtc--------ttttaac-
F4ZCJ8_E1B19K-01        ---------------gatttgctgagcttttgtc--------ttttaac-
                                        ***  *  * * **** *        ******* 

A0A482EVC6_E1B19K-      gtgcaatgcagagtttaggtcctggggtgattggtatgagcggggtaaca
A0A7U3RWV6_E1B19K-      --------------------cctggaatttttg---------------ca
A0A1S6ELT2_E1B19K-      --------------------cctggaatatttg---------------ca
B5SNR1_E1B19K-01        --------------------cctggaatttttg---------------ca
P10544_E1B19K-01        --------------------cctggaatttttg---------------ca
A0A482EVC6_E1B19K-      --------------------cctggaatttttg---------------ca
A0A898KBR0_E1B19K-      --------------------cctggaatttttg---------------ca
A0A898KBS1_E1B19K-      --------------------cctggaatttttg---------------ca
W0S1G8_E1B19K-01        --------------------cctggaatttttg---------------ca
A0A3G4W995_E1B19K-      --------------------cctggaatttttg---------------ca
A0A898KBW7_E1B19K-      --------------------cctggaatttttg---------------ca
A0A3G8W407_E1B19K-      --------------------cctggaatttttg---------------ca
F4ZCJ8_E1B19K-01        --------------------cctggaatttttg---------------ca
                                            *****  *  ***               **

A0A482EVC6_E1B19K-      tttaataatgtcagatttgcagcagatggatttaatggcaaggtgtttgc
A0A7U3RWV6_E1B19K-      tct-------ttaaatttggg-----------------------------
A0A1S6ELT2_E1B19K-      tct-------ttaaatttggg-----------------------------
B5SNR1_E1B19K-01        tct-------ttaaatttggg-----------------------------
P10544_E1B19K-01        tct-------ttaaatttggg-----------------------------
A0A482EVC6_E1B19K-      tct-------ttaaatttggg-----------------------------
A0A898KBR0_E1B19K-      tct-------ttaaatttggg-----------------------------
A0A898KBS1_E1B19K-      tct-------ttaaatttggg-----------------------------
W0S1G8_E1B19K-01        tct-------ttaaatttggg-----------------------------
A0A3G4W995_E1B19K-      tct-------ttaaatttggg-----------------------------
A0A898KBW7_E1B19K-      tct-------ttaaatttggg-----------------------------
A0A3G8W407_E1B19K-      tct-------ttaaatttggg-----------------------------
F4ZCJ8_E1B19K-01        tct-------ttaaatttggg-----------------------------
                        * *       * * *****                               

A0A482EVC6_E1B19K-      ttctaccactcaattaactttgcatggtgtgttttttcaaaattgcagcg
A0A7U3RWV6_E1B19K-      --ccaccactca-------------------tttttccagga--------
A0A1S6ELT2_E1B19K-      --ccaccactca-------------------tttttccagga--------
B5SNR1_E1B19K-01        --ccaccactca-------------------tttttccagga--------
P10544_E1B19K-01        --ccaccactca-------------------tttttccagga--------
A0A482EVC6_E1B19K-      --ccaccactca-------------------tttttccagga--------
A0A898KBR0_E1B19K-      --ccaccactca-------------------tttttccagga--------
A0A898KBS1_E1B19K-      --ccaccactca-------------------tttttccagga--------
W0S1G8_E1B19K-01        --ccaccactca-------------------tttttccagga--------
A0A3G4W995_E1B19K-      --ccaccactca-------------------tttttccagga--------
A0A898KBW7_E1B19K-      --ccaccactca-------------------tttttccagga--------
A0A3G8W407_E1B19K-      --ccaccactca-------------------tttttccagga--------
F4ZCJ8_E1B19K-01        --ccaccactca-------------------tttttccagga--------
                          * ********                   ***** **  *        

A0A482EVC6_E1B19K-      gtgtttgcgtggattcctggggtagggtgtctgccagaggttgtacgttt
A0A7U3RWV6_E1B19K-      --------------------------------------------------
A0A1S6ELT2_E1B19K-      --------------------------------------------------
B5SNR1_E1B19K-01        --------------------------------------------------
P10544_E1B19K-01        --------------------------------------------------
A0A482EVC6_E1B19K-      --------------------------------------------------
A0A898KBR0_E1B19K-      --------------------------------------------------
A0A898KBS1_E1B19K-      --------------------------------------------------
W0S1G8_E1B19K-01        --------------------------------------------------
A0A3G4W995_E1B19K-      --------------------------------------------------
A0A898KBW7_E1B19K-      --------------------------------------------------
A0A3G8W407_E1B19K-      --------------------------------------------------
F4ZCJ8_E1B19K-01        --------------------------------------------------
                                                                          

A0A482EVC6_E1B19K-      gtgggatgttggaaagggctggtggggcaaaacaagagccaaatgtctgt
A0A7U3RWV6_E1B19K-      ----------------------------------------aattgtgatc
A0A1S6ELT2_E1B19K-      ----------------------------------------aattgtgatc
B5SNR1_E1B19K-01        ----------------------------------------aattgtgatc
P10544_E1B19K-01        ----------------------------------------aattgtgatc
A0A482EVC6_E1B19K-      ----------------------------------------aattgtgatc
A0A898KBR0_E1B19K-      ----------------------------------------aattgtgatc
A0A898KBS1_E1B19K-      ----------------------------------------aattgtgatc
W0S1G8_E1B19K-01        ----------------------------------------aattgtgatc
A0A3G4W995_E1B19K-      ----------------------------------------aattgtgatc
A0A898KBW7_E1B19K-      ----------------------------------------aattgtgatc
A0A3G8W407_E1B19K-      ----------------------------------------aattgtgatc
F4ZCJ8_E1B19K-01        ----------------------------------------aattgtgatc
                                                                ** ***    

A0A482EVC6_E1B19K-      aaaaaaatgtgtgtttgaacgatgcattttggctatggtggtagaaggcc
A0A7U3RWV6_E1B19K-      aaaaacttagattttt----------------------------------
A0A1S6ELT2_E1B19K-      aaaaacttagattttt----------------------------------
B5SNR1_E1B19K-01        aaaaacttagattttt----------------------------------
P10544_E1B19K-01        aaaaacttagattttt----------------------------------
A0A482EVC6_E1B19K-      aaaaacttagattttt----------------------------------
A0A898KBR0_E1B19K-      aaaaacttagattttt----------------------------------
A0A898KBS1_E1B19K-      aaaaacttagattttt----------------------------------
W0S1G8_E1B19K-01        aaaaacttagattttt----------------------------------
A0A3G4W995_E1B19K-      aaaaacttagattttt----------------------------------
A0A898KBW7_E1B19K-      aaaaacttagattttt----------------------------------
A0A3G8W407_E1B19K-      aaaaacttagattttt----------------------------------
F4ZCJ8_E1B19K-01        aaaaacttagattttt----------------------------------
                        *****  *   * ***                                  

A0A482EVC6_E1B19K-      aggcgcgaattcgacataatgcgggttccgaaaatgtgtgctttttactg
A0A7U3RWV6_E1B19K-      ----------------------------------------cttcccccgg
A0A1S6ELT2_E1B19K-      ----------------------------------------cttcccccgg
B5SNR1_E1B19K-01        ----------------------------------------cttcccccgg
P10544_E1B19K-01        ----------------------------------------cttcccccgg
A0A482EVC6_E1B19K-      ----------------------------------------cttcccccgg
A0A898KBR0_E1B19K-      ----------------------------------------cttcccccgg
A0A898KBS1_E1B19K-      ----------------------------------------cttcccccgg
W0S1G8_E1B19K-01        ----------------------------------------cttcccccgg
A0A3G4W995_E1B19K-      ----------------------------------------cttcccccgg
A0A898KBW7_E1B19K-      ----------------------------------------cttcccccgg
A0A3G8W407_E1B19K-      ----------------------------------------cttcccccgg
F4ZCJ8_E1B19K-01        ----------------------------------------cttcccccgg
                                                                ***    * *

A0A482EVC6_E1B19K-      ctgaagggaactgccagtgttaagcataatatgatttgtggcactggtca
A0A7U3RWV6_E1B19K-      ccg--------------------------tacggtttctgg----ggtgg
A0A1S6ELT2_E1B19K-      ccg--------------------------tacggtttctgg----gcttg
B5SNR1_E1B19K-01        ccg--------------------------tacggtttctgg----gcttg
P10544_E1B19K-01        ccg--------------------------tacggtttctgg----gcttg
A0A482EVC6_E1B19K-      ccg--------------------------tacggtttctgg----gcttg
A0A898KBR0_E1B19K-      ccg--------------------------tacggtttctgg----gcttg
A0A898KBS1_E1B19K-      ccg--------------------------tacggtttctgg----gcttg
W0S1G8_E1B19K-01        ccg--------------------------tacggtttctgg----gcttg
A0A3G4W995_E1B19K-      ccg--------------------------tacggtttctgg----gcttg
A0A898KBW7_E1B19K-      ccg--------------------------tgcggtttctgg----gcttg
A0A3G8W407_E1B19K-      ccg--------------------------tacggtttctgg----gcttg
F4ZCJ8_E1B19K-01        ccg--------------------------tacggtttctgg----gcttg
                        * *                          *  * *** ***    * *  

A0A482EVC6_E1B19K-      ctctcagctgctaacttgcgcagatggaaactgtcagactctaaaagtga
A0A7U3RWV6_E1B19K-      gtcttatctgg---------------------------------------
A0A1S6ELT2_E1B19K-      ctttcatttgt---------------------------------------
B5SNR1_E1B19K-01        ctttcatttgt---------------------------------------
P10544_E1B19K-01        ctttcatttgt---------------------------------------
A0A482EVC6_E1B19K-      ctttcatttgt---------------------------------------
A0A898KBR0_E1B19K-      ctttcatttgt---------------------------------------
A0A898KBS1_E1B19K-      ctttcatttgt---------------------------------------
W0S1G8_E1B19K-01        ctttcatttgt---------------------------------------
A0A3G4W995_E1B19K-      ctttcatttgt---------------------------------------
A0A898KBW7_E1B19K-      ctttcatttgt---------------------------------------
A0A3G8W407_E1B19K-      ctttcatttgt---------------------------------------
F4ZCJ8_E1B19K-01        ctttcatttgt---------------------------------------
                         * * *  **                                        

A0A482EVC6_E1B19K-      ttcatgtggtttcccatcagcgccgcccctggcctgtttttgagcataac
A0A7U3RWV6_E1B19K-      tgcgtatgtattcaagagagcgcc-------------------------t
A0A1S6ELT2_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
B5SNR1_E1B19K-01        tttatattggatcaatggagcgcc-------------------------c
P10544_E1B19K-01        tttatattggatcaatggagcgcc-------------------------c
A0A482EVC6_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
A0A898KBR0_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
A0A898KBS1_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
W0S1G8_E1B19K-01        tttatattggatcaatggagcgcc-------------------------c
A0A3G4W995_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
A0A898KBW7_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
A0A3G8W407_E1B19K-      tttatattggatcaatggagcgcc-------------------------c
F4ZCJ8_E1B19K-01        tttatattggatcaatggagcgcc-------------------------c
                        *   * *    **     ******                          

A0A482EVC6_E1B19K-      atgcttatgcgttgtaccatgcatttgggggctcgtcgtggcatgttttc
A0A7U3RWV6_E1B19K-      atacccatctgtcg------------gaggg-------------gtatac
A0A1S6ELT2_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
B5SNR1_E1B19K-01        aaacccatctgtcg------------gaggg-------------atatac
P10544_E1B19K-01        aaacccatctgtcg------------gaggg-------------atatac
A0A482EVC6_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
A0A898KBR0_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
A0A898KBS1_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
W0S1G8_E1B19K-01        aaacccatctgtcg------------gaggg-------------gtatac
A0A3G4W995_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
A0A898KBW7_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
A0A3G8W407_E1B19K-      aaacccatctgtcg------------gaggg-------------gtatac
F4ZCJ8_E1B19K-01        aaacccatctgtcg------------gaggg-------------gtatac
                        *  *  **  ** *            * ***              * * *

A0A482EVC6_E1B19K-      tccatatcagagtaatttttgccatactaaagttttaatggaaactgatg
A0A7U3RWV6_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
A0A1S6ELT2_E1B19K-      tctggatta-------------catgacaatggctctgtggagaaccctg
B5SNR1_E1B19K-01        tctggatta-------------catgacaatggccctgtggagaaccctg
P10544_E1B19K-01        tctggatta-------------catgacaatggccctgtggagaaccctg
A0A482EVC6_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
A0A898KBR0_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
A0A898KBS1_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
W0S1G8_E1B19K-01        tctggatta-------------catgacaatggccctgtggagaaccctg
A0A3G4W995_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
A0A898KBW7_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
A0A3G8W407_E1B19K-      tctggatta-------------catgacaatggccctgtggagaaccctg
F4ZCJ8_E1B19K-01        tctggatta-------------catgacaatggccctgtggagaaccctg
                        **   ** *             ***   ** *      **** *    **

A0A482EVC6_E1B19K-      ctttttcgcgggtgtggtggagcggggtgtttgatttgaccatagagctg
A0A7U3RWV6_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
A0A1S6ELT2_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
B5SNR1_E1B19K-01        c-----------tgcggaggaagagggtcttaggtt--------------
P10544_E1B19K-01        c-----------tgcggaggaagagggtcttaggtt--------------
A0A482EVC6_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
A0A898KBR0_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
A0A898KBS1_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
W0S1G8_E1B19K-01        c-----------tgcggaggaagagggtcttaggtt--------------
A0A3G4W995_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
A0A898KBW7_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
A0A3G8W407_E1B19K-      c-----------tgcggaggaagagggtcttaggtt--------------
F4ZCJ8_E1B19K-01        c-----------tgcggaggaagagggtcttaggtt--------------
                        *           ** ** ***   **** ** * **              

A0A482EVC6_E1B19K-      tataaagtggtgagatatgatgagttaaaggctcgttgtcgcccctgtga
A0A7U3RWV6_E1B19K-      ------------------------------gctcgccggcgc--------
A0A1S6ELT2_E1B19K-      ------------------------------gctcgccggcgc--------
B5SNR1_E1B19K-01        ------------------------------gctcgccggcgc--------
P10544_E1B19K-01        ------------------------------gctcgccggcgc--------
A0A482EVC6_E1B19K-      ------------------------------gctcgccggcgc--------
A0A898KBR0_E1B19K-      ------------------------------gctcgccggcgc--------
A0A898KBS1_E1B19K-      ------------------------------gctcgccggcgc--------
W0S1G8_E1B19K-01        ------------------------------gctcgccggcgc--------
A0A3G4W995_E1B19K-      ------------------------------gctcgccggcgc--------
A0A898KBW7_E1B19K-      ------------------------------gctcgccggcgc--------
A0A3G8W407_E1B19K-      ------------------------------gctcgccggcgc--------
F4ZCJ8_E1B19K-01        ------------------------------gctcgccggcgc--------
                                                      *****  * ***        

A0A482EVC6_E1B19K-      gtgtggagccaatcacatcaggttatatccagcaactct-----------
A0A7U3RWV6_E1B19K-      ------agcc--tccgcacggtctggatcccacagtgcg-----------
A0A1S6ELT2_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcg------ggagg
B5SNR1_E1B19K-01        ------agcc--tccgcacggtctggatc---cagtgcg------ggagg
P10544_E1B19K-01        ------agcc--tccgcacggtctggatc---cagtgcg-----------
A0A482EVC6_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcg------ggagg
A0A898KBR0_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcg-----------
A0A898KBS1_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcg---------gg
W0S1G8_E1B19K-01        ------agcc--tccgcacggtctggatc---cagtgcg-----------
A0A3G4W995_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcg-----------
A0A898KBW7_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcgggaggaggagg
A0A3G8W407_E1B19K-      ------agcc--tccgcacggtctggatc---cagtgcg-----------
F4ZCJ8_E1B19K-01        ------agcc--tccgcacggtctggatc---cagtgcg---ggaggagg
                              ****  **    * *  *  ***   **   *            

A0A482EVC6_E1B19K-      -gaacgtgacggagcagctgcgcacggaccatcagatgttgtcgtgtctt
A0A7U3RWV6_E1B19K-      -ggaggaggaggaggagggggaggagaac---------------------
A0A1S6ELT2_E1B19K-      aggaggaggaggaggaggagagggagaacctgagggccggtctggatcct
B5SNR1_E1B19K-01        aggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
P10544_E1B19K-01        -ggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
A0A482EVC6_E1B19K-      aggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
A0A898KBR0_E1B19K-      ----ggaggaggaggaggaggaggagaacctgagggccggtctggatcct
A0A898KBS1_E1B19K-      aggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
W0S1G8_E1B19K-01        -ggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
A0A3G4W995_E1B19K-      -------ggaggaggaggaggaggagaacctgagggccggtctggatcct
A0A898KBW7_E1B19K-      aggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
A0A3G8W407_E1B19K-      ----------ggaggaggaggaggagaacctgagggccggtctggatcct
F4ZCJ8_E1B19K-01        aggaggaggaggaggaggaggaggagaacctgagggccggtctggatcct
                                  **** **  *     * **                     

A0A482EVC6_E1B19K-      cgcaccgactacgaatccagcgatgaggattaa
A0A7U3RWV6_E1B19K-      ------------------------------tag
A0A1S6ELT2_E1B19K-      caaacggaat------------------tgtaa
B5SNR1_E1B19K-01        caaacggaat------------------tgtaa
P10544_E1B19K-01        caaacggaat------------------tgtaa
A0A482EVC6_E1B19K-      caaacggaat------------------tgtaa
A0A898KBR0_E1B19K-      caaacggaat------------------tgtaa
A0A898KBS1_E1B19K-      caaacggaat------------------tgtaa
W0S1G8_E1B19K-01        caaacggaat------------------tgtaa
A0A3G4W995_E1B19K-      caaacggaat------------------tgtaa
A0A898KBW7_E1B19K-      caaacggaat------------------tgtaa
A0A3G8W407_E1B19K-      caaacggaat------------------tgtaa
F4ZCJ8_E1B19K-01        caaacggaat------------------tgtaa
                                                      ** 

© 1998-2022Legal notice