Dataset for CDS E1B19K of organism Human adenovirus C serotype 6

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E1U5L6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus C serotype 6 GN=E1B19K (length=528 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacagcaggaggaagccaggcggcggcggcggcag
gagcagagcccatggaacccgagagccggcctggaccctcgggaatga
© 1998-2020Legal notice