Dataset for CDS E1B19K of organism Human adenovirus C serotype 6

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E1U5L6_E1B19K-01      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      --------------------------------------------------
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      --------------------------------------------------
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      --------------------------------------------------
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      --------------------------------------------------
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      --------------------------------------------------
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      --------------------------------------------------
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
E1U5L6_E1B19K-03      -----atggagcgaagaaacccatctgagcggggggtacctgctggattt
E1U5L6_E1B19K-02      -----atggagcgaagaaacccatctgagcggggggtacctgctggattt
E1U5L6_E1B19K-04      -----atggagcgaagaaacccatctgagcggggggtacctgctggattt

E1U5L6_E1B19K-01      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
E1U5L6_E1B19K-03      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
E1U5L6_E1B19K-02      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
E1U5L6_E1B19K-04      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc

E1U5L6_E1B19K-01      tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacag
E1U5L6_E1B19K-03      tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacag
E1U5L6_E1B19K-02      tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacag
E1U5L6_E1B19K-04      tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacag

E1U5L6_E1B19K-01      caggaggaagccaggcggcggcggcggcaggagcagagcccatggaaccc
E1U5L6_E1B19K-03      caggaggaagccaggcggcggcggcggcaggagcagagcccatggaaccc
E1U5L6_E1B19K-02      caggaggaagccaggcggcggcggcggcaggagcagagcccatggaaccc
E1U5L6_E1B19K-04      caggaggaagccaggcggcggcggcggcaggagcagagcccatggaaccc

E1U5L6_E1B19K-01      gagagccggcctggaccctcgggaatga----------------------
E1U5L6_E1B19K-03      gagagccggcctggaccctcgggaatgaatgttgt---------------
E1U5L6_E1B19K-02      gagagccggcctggaccctcgggaatgaatgttgtacaggtggctgaact
E1U5L6_E1B19K-04      gagagccggcctggaccctcgggaatgaatgttgt---------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      gtttccagaactgagacgcattttaaccattaacgaggatgggcaggggc
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      taaagggggtaaagagggagcggggggcttctgaggctacagaggaggct
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      aggaatctaacttttagcttaatgaccagacaccgtcctgagtgtgttac
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      ttttcagcagattaaggataattgcgctaatgagcttgatctgctggcgc
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      agaagtattccatagagcagctgaccacttactggctgcagccaggggat
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      gattttgaggaggctattagggtatatgcaaaggtggcacttaggccaga
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      ttgcaagtacaagattagcaaacttgtaaatatcaggaattgttgctaca
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      tttctgggaacggggccgaggtggagatagatacggaggatagggtggcc
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      tttagatgtagcatgataaatatgtggccgggggtgcttggcatggacgg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      ggtggttattatgaatgtgaggtttactggtcccaattttagcggtacgg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      ttttcctggccaataccaatcttatcctacacggtgtaagcttctatggg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      tttaacaatacctgtgtggaagcctggaccgatgtaagggttcggggctg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      tgccttttactgctgctggaagggggtggtgtgtcgccccaaaagcaggg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      cttcaattaagaaatgcctgtttgaaaggtgtaccttgggtatcctgtct
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      gagggtaactccagggtgcgccacaatgtggcctccgactgtggttgctt
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      tatgctagtgaaaagcgtggctgtgattaagcataacatggtgtgtggca
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      actgcgaggacagggcctctcagatgctgacctgctcggacggcaactgt
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      --------------------------------------------------
E1U5L6_E1B19K-02      cacttgctgaagaccattcacgtagccagccactctcgcaaggcctggcc
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      -----------------------------------------------aca
E1U5L6_E1B19K-02      agtgtttgagcacaacatactgacccgctgttccttgcatttgggtaaca
E1U5L6_E1B19K-04      -----------------------------------------------aca

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      g-------------------------------------------------
E1U5L6_E1B19K-02      ggaggggggtgttcctaccttaccaatgcaatttgagtcacactaagata
E1U5L6_E1B19K-04      ggaggggggtgttcctaccttaccaatgcaatttgagtcacactaa----

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      ---------cccgagagcatgtccaaggtgaacctgaacggggtgtttga
E1U5L6_E1B19K-02      ttgcttgagcccgagagcatgtccaaggtgaacctgaacggggtgtttga
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      catgaccatgaagatctggaaggtgctgaggtacgatgagacccgcacca
E1U5L6_E1B19K-02      catgaccatgaagatctggaaggtgctgaggtacgatgagacccgcacca
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      ggtgcagaccctgcgagtgtggcggtaaacatattaggaaccagcctgtg
E1U5L6_E1B19K-02      ggtgcagaccctgcgagtgtggcggtaaacatattaggaaccagcctgtg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      --------------------------------------------------
E1U5L6_E1B19K-03      atgctggatgtgaccgaggagctgaggcccgatcacttggtgctggcctg
E1U5L6_E1B19K-02      atgctggatgtgaccgaggagctgaggcccgatcacttggtgctggcctg
E1U5L6_E1B19K-04      --------------------------------------------------

E1U5L6_E1B19K-01      -------------------------------------------
E1U5L6_E1B19K-03      cacccgcgctgagtttggctctagcgatgaagatacagattga
E1U5L6_E1B19K-02      cacccgcgctgagtttggctctagcgatgaagatacagattga
E1U5L6_E1B19K-04      -------------------------------------------

© 1998-2023Legal notice