Dataset for CDS classical BH3-containing proteins of organism Salmo trutta

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A673WET2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Salmo trutta GN=BCL2L11 (length=645 residues).
atgtccgattcgtccagacaacaaaatcagtccaatggctcgaccatcctaattgagagagggaaatacggagaattgaa
tcccggtggcggagcagcctccggtgccgaaccgactgacaacccccagttcagcgaaagggaccagcagtcacggggag
gaataatgatgccgaatagtctgcttggtttccagtcgaggtcgccgttgttcagaacactgtccaggtcatccagtgga
tatttttcgttcgacagcgattctattccaagctccccgctattgaaagataacaagtcgacacagactccgagcccatc
tagccaagtcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaatcgagattatgatgcgtggcccaacc
ccctccacccctatagaccacggccaccgccaactgcaggggacatgtggccagagacactgatcggtcaggagcttcag
cgcattggagacgagtttaacgatctcgtcatacatcgccttgctgaaggaaacggtcaagttgcccaggaaaacctgca
gcagatgcaccaagagcccgccttcctactgtggatggggctcctgattggacgactattacagatcatcctgcagagaa
gatga
>gnl|bcl2dbcds|A0A673XGV4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Salmo trutta GN=BCL2L11 (length=657 residues).
caaaataaaatatataaaaagagaggctactactgcaacctgtgggtggcgataatggaccaaggggaaagcggagagtc
gcatcccggtggcggagctgcctcccgtgccgaaccgtctgacaacccccagtcctgcgaaggggaccagcagtcactgg
gaggaataatgattccgaatagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtccagatcctccagt
ggatatttttcgttcgacagcgattctattccaagctccccgctattgaaagataaatcgacacagactccgagcccatc
tagccaagtcattacccacgcactgcagcgcatgtctcgagcactggagaccgggcgagattatggtaaggcacacgtgt
ggcccaaccccctccggccctatagatcacgcccaccaccgactgcgggggacatgcggccagagatactcatcggtcag
gagcttcagcgcattggagatgagtttaacaacctcatcatacataggcgccttgcaggtagaaacggtcaggttgccca
ggggaacctgcagcacatgcaccaagagcccgccttcctactgtggatgagtcttctgattggacgactattacagataa
tcctgcggagaagatga
>gnl|bcl2dbcds|A0A673YQV3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo trutta GN=BMF (length=489 residues).
atggacgatgaggaggatgatgtgtttgaaccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctggga
gagcgaggagagcgaggggggatggagaggctcaatcagcagccccagcagccagcacgcagcatagagatctgcattgg
acagaaactccaactcatcggagaccagttccaccaagaacacgttcaagtgtatcaccgaaaccaaaggaacatgaggc
ccttgtggaggcgcctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggagagagcaggg
tggaggtga
>gnl|bcl2dbcds|A0A673ZHY7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo trutta GN=BAD (length=471 residues).
atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacaagatgagtctgaccactcaggaaccac
acactacccagaatttcagctccattatgtctccactaggacgagcatcagaccacgaccaggtgagcgagtccggctct
actccgagtcccaggtgtgctcccaggttggcagaagggaagacacagagtttcaggatgtgatgactcctactgaggag
ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctccgacactgtgggctgcaaagaaatatggccg
ccagctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaacccaagagagggataagcccaggagggg
tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
>gnl|bcl2dbcds|A0A674AVP9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo trutta GN=BAD (length=444 residues).
atggaccacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacacaactcagaatttcagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattattccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A674DKC6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo trutta GN=BAD (length=1263 residues).
tccctctcctctctctctctgcctctcctcctttccctctcctctctctccctctcctctctctctccctctcctctctc
ccccctcctctccctctcctctctcctctctcgccctctccgccttcctctgcctctctctctctctgcctctccctcct
cctctcctctcctctgcctctctccctcctcgctctcttgcctctcgctctcctctctctcctctcctctctctcctccc
tctcctctctctctctctctgcctctcctccttccctctcctctctctcccctctcctctctctctctccctctcctctc
cctctcctctctctctccctctcctctctctctcctctcccctctcctcctctcttctctctctctctgcctctcctcct
ttccctctcctctctctccccctctcctctctctctccctctcctctccctctcctctctctcctccctctcctctctct
ctccctctcctctctctctccctctcctctctctctccctctcctctctctgcctctcctcctttccctctccctctctc
tctccctctcctctctctctttctctgcctcttttctctctctttgcctcttttctctctctctgcctcacctcctgtct
ctctctctctctcctcacgtctctttcccccctttccgctctctatctcgctcccctctctctccacccctcttcccctc
catctcactgctttcttgtttcccctcctcacttcctcttcctctgtagatgtcagcatggctcagatgtttactatatc
agacagtgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaatcgtctgccggaaaggggatgactggcg
gtccaataggccacaccctcactgtgcctgagatgagactggcaggagagggtcggttgaggatgaactcagagtcccag
gcccaggagctccagggtagggggccaggggtggaaggcgtgcccacagacggagcatctttccggggtcgctcccagtc
ggccccccctgccctctgggcagccaagagatatgggcggcagctccgacgcatgagtgatgagtttgatacgtggctgg
ataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagtcccccagctggtgggcctacctg
ttcagtcataaggagacagagacagaacatacccctaccatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A674EF64_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo trutta GN=BMF (length=486 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagccca
gaccactcttctacggcaacgcaggctttcgattgcactttccagcacggtttgagcaggttggagaccaggggcctcag
gagcagcatcagggggagcgagggaggatggaacggcttctacagcagccagtgcaaagcatggaggtctgcattggaca
gaaactccaactcatcggagaccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggccct
tgtggtggcgcctggcctcagctctgttcaccctgctgtttgagcaggaggccatcgctggaagggggagagcagggtgg
aggtga
© 1998-2020Legal notice