Dataset for CDS classical BH3-containing proteins of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tccctctcctctctctctctgcctctcctcctttccctctcctctctctc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       cctctcctctctctctccctctcctctctcccccctcctctccctctcct
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       ctctcctctctcgccctctccgccttcctctgcctctctctctctctgcc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tctccctcctcctctcctctcctctgcctctctccctcctcgctctcttg
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       cctctcgctctcctctctctcctctcctctctctcctccctctcctctct
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       ctctctctctgcctctcctccttccctctcctctctctcccctctcctct
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       ctctctctccctctcctctccctctcctctctctctccctctcctctctc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tctcctctcccctctcctcctctcttctctctctctctgcctctcctcct
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       ttccctctcctctctctccccctctcctctctctctccctctcctctccc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tctcctctctctcctccctctcctctctctctccctctcctctctctctc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       cctctcctctctctctccctctcctctctctgcctctcctcctttccctc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tccctctctctctccctctcctctctctctttctctgcctcttttctctc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      --------------atgtccgattcgtccag-------------------
A0A673XGV4_BCL2L11      ------------------caaaataaaatat-------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tctttgcctcttttctctctctctgcctcacctcctgtctctctctctct
A0A673ZHY7_BAD-01       ----------------------atggaccac-------------------
A0A674AVP9_BAD-01       ----------------------atggaccac-------------------
                                                                          

A0A673WET2_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       ctcctcacgtctctttcccccctttccgctctctatctcgctcccctctc
A0A673ZHY7_BAD-01       --------------------------------------------------
A0A674AVP9_BAD-01       --------------------------------------------------
                                                                          

A0A673WET2_BCL2L11      -------------------acaacaaaatcagtccaatggctcgacc---
A0A673XGV4_BCL2L11      -------------------ataaaaagag-aggctactactgcaacctgt
A0A673YQV3_BMF-01       --------------------------------------------------
A0A674EF64_BMF-01       --------------------------------------------------
A0A674DKC6_BAD-01       tctccacccctcttcccctccatctcactgctttcttgtttcccctcctc
A0A673ZHY7_BAD-01       -------------------acacatgattg--------------------
A0A674AVP9_BAD-01       -------------------acacatgattg--------------------
                                                                          

A0A673WET2_BCL2L11      -----atcctaattgagagagggaaatacggagaattgaatcccggtggc
A0A673XGV4_BCL2L11      gggtggcgataatggaccaaggggaaagcggagagtcgcatcccggtggc
A0A673YQV3_BMF-01       ---------------atggacgatgaggaggatgatgtgtttg---aacc
A0A674EF64_BMF-01       ---------------atggatgatgaggaggatgatgtgtttg---tgcc
A0A674DKC6_BAD-01       acttcctcttcctctgtagatgtcagcatggctcagatgtttactatatc
A0A673ZHY7_BAD-01       --------------tgtggatgacaacccagaaaccatgaatg------a
A0A674AVP9_BAD-01       --------------tgtggatg----------------------------
                                           * *                            

A0A673WET2_BCL2L11      gga-----gcagcctccggtgccgaaccgactgacaacccccagttcagc
A0A673XGV4_BCL2L11      gga-----gctgcctcccgtgccgaaccgtctgacaacccccagtcctgc
A0A673YQV3_BMF-01       aga---ctcccactgctggcgcacagccttcagggagataaagtacgagg
A0A674EF64_BMF-01       agactcctcccactgctggcgcacagccttcagggaaataaagtacgagg
A0A674DKC6_BAD-01       aga----------cagtgagtcagagccctcagaggaggtaggagaaacc
A0A673ZHY7_BAD-01       aca----------agatgagtctgaccactcag-----------------
A0A674AVP9_BAD-01       --a----------atgtgagtctgatcactcag-----------------
                          *                  *  * *   * *                 

A0A673WET2_BCL2L11      gaaagggaccagcagtcacggggaggaataatgatgccgaatagtctgct
A0A673XGV4_BCL2L11      gaaggggaccagcagtcactgggaggaataatgattccgaatagtctgct
A0A673YQV3_BMF-01       acagggga---------acccaga---------caccca---gccctgtc
A0A674EF64_BMF-01       acagaggc---------acccaga---------caccca---gccctgcc
A0A674DKC6_BAD-01       gaaaaggaccaatcgtctgccggaaaggggatgactggc---ggtccaat
A0A673ZHY7_BAD-01       -----gaaccacacactacccaga---------atttca---gctccatt
A0A674AVP9_BAD-01       -----gaaccacacacaactcaga---------atttca---gctcc---
                             *                **                     *    

A0A673WET2_BCL2L11      tggtttccagtcgaggtcgccgttgttcagaacactgtccaggtcatcca
A0A673XGV4_BCL2L11      tggtttccagtcgaggtcgccggtgttcagaacactgtccagatcctcca
A0A673YQV3_BMF-01       ctgccactg------------------cccaataatatgctgccctgcgg
A0A674EF64_BMF-01       ctggcactg------------------cccaacgacatgctgccctgtgg
A0A674DKC6_BAD-01       aggccacac------------------cc--tcactgtgc----------
A0A673ZHY7_BAD-01       atgtctcca------------------ct--aggacgagc----------
A0A674AVP9_BAD-01       atgtctcaa------------------ct--acaatgagc----------
                          *   *                    *           *          

A0A673WET2_BCL2L11      gtggatatttttcgttcgacagcgattctattccaagctccccgctattg
A0A673XGV4_BCL2L11      gtggatatttttcgttcgacagcgattctattccaagctccccgctattg
A0A673YQV3_BMF-01       ggtggcccaggagcccagaccactcttct------------acggcaacg
A0A674EF64_BMF-01       ggtggcccaggagcccagaccactcttct------------acggcaacg
A0A674DKC6_BAD-01       -------------ctgagatga-gactgg------------caggagagg
A0A673ZHY7_BAD-01       -------------atcagaccacgac---------------caggtgag-
A0A674AVP9_BAD-01       -------------aacagaccaagac---------------caggtgag-
                                         **                        *      

A0A673WET2_BCL2L11      aaagataacaagtcgacacagactccgag-------ccca-tctagccaa
A0A673XGV4_BCL2L11      aaagat---aaatcgacacagactccgag-------ccca-tctagccaa
A0A673YQV3_BMF-01       caggctttcgattgcact-----tcccag-------cgcagtttgagcgt
A0A674EF64_BMF-01       caggctttcgattgcact-----ttccag-------cacggtttgagcag
A0A674DKC6_BAD-01       gtcggttgaggatgaactcagagtcccagg------cccag---------
A0A673ZHY7_BAD-01       --cgagtccggctctactccgagtcccaggtgtgctcccaggttggcaga
A0A674AVP9_BAD-01       --cgagtccggctctactcagagtcccaggtgtgctcccaggttggcaaa
                           *        *  **      * * **       * *           

A0A673WET2_BCL2L11      gtcatgactcacgcactgcagcgcatg---tctcaagcacaggagaccaa
A0A673XGV4_BCL2L11      gtcattacccacgcactgcagcgcatg---tctcgagcactggagaccgg
A0A673YQV3_BMF-01       gttggagaccaggggcctctgggagag-----------cgaggagagcga
A0A674EF64_BMF-01       gttggagaccaggggcctcaggagcag--------catcagggggagcga
A0A674DKC6_BAD-01       ------------gagctccagggtaggggg---ccaggggtggaaggcgt
A0A673ZHY7_BAD-01       agggaagacacagagtttcaggatgtgatgactcctactgaggagggcgg
A0A674AVP9_BAD-01       agggaagacacagagtttcaggatgtgatgactcctactgaggagggtgg
                                    *     * *     *              **       

A0A673WET2_BCL2L11      tcgagattatg---------atgcgtggcccaaccccctccacccctata
A0A673XGV4_BCL2L11      gcgagattatggtaaggcacacgtgtggcccaaccccctccggccctata
A0A673YQV3_BMF-01       gggg--ggatgga-------gaggct----------------------ca
A0A674EF64_BMF-01       ggga--ggatgga-------acggct----------------------t-
A0A674DKC6_BAD-01       gcccacagacgga-------gcatctttccggggtcgctc-------cca
A0A673ZHY7_BAD-01       tggc---gatggg-------gctcctttccgaagccgatc-------aca
A0A674AVP9_BAD-01       gggt---gatggg-------gcttcattccgaggccgatc-------aca
                                * *                                       

A0A673WET2_BCL2L11      gaccacggccaccgccaactgcaggggacatgtggccagagacactgatc
A0A673XGV4_BCL2L11      gatcacgcccaccaccgactgcgggggacatgcggccagagatactcatc
A0A673YQV3_BMF-01       atcagcagccccagcagccagcacgcagcat------agagatctgcatt
A0A674EF64_BMF-01       --------ctacagcagccagtgcaaagcat------ggaggtctgcatt
A0A674DKC6_BAD-01       gtcggccccccctgcc--ctctgggcagcca------agagata-----t
A0A673ZHY7_BAD-01       gtctgctcctccgaca--ctgtgggctgcaa------agaaata-----t
A0A674AVP9_BAD-01       gtctgctcctcctgca--ctgtgggctgcaa------agaaata-----t
                                *  *  *   *         *         **          

A0A673WET2_BCL2L11      ggtcaggagcttcagcgcattggagacgagtttaacgatctcgtcataca
A0A673XGV4_BCL2L11      ggtcaggagcttcagcgcattggagatgagtttaacaacctcatcataca
A0A673YQV3_BMF-01       ggacagaaactccaactcatcggagaccagttcca---------------
A0A674EF64_BMF-01       ggacagaaactccaactcatcggagaccagttcta---------------
A0A674DKC6_BAD-01       gggcggcagctccgacgcatgagtgatgagtttga---------------
A0A673ZHY7_BAD-01       ggccgccagctgaggaggatgagtgatgaatttga---------------
A0A674AVP9_BAD-01       ggctgccagctgaggaggatgagtgatgaatttga---------------
                        **     * **       **  * **  * **  *               

A0A673WET2_BCL2L11      t---cgccttgctgaaggaaacg-gtcaagttgcccaggaaaacctgcag
A0A673XGV4_BCL2L11      taggcgccttgcaggtagaaacg-gtcaggttgcccaggggaacctgcag
A0A673YQV3_BMF-01       ----ccaagaacacgttcaagtgtatcaccgaaaccaaaggaacatgagg
A0A674EF64_BMF-01       ----ccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgagg
A0A674DKC6_BAD-01       ----tacgtggctggataaaggg-------gagatgaggcgggtgaagag
A0A673ZHY7_BAD-01       ----cacctggctcgacaaaggg-------gaacccaagagagggataag
A0A674AVP9_BAD-01       ----cacctggctcgacaaaggg-------gtgcccaagagagggattat
                                   *      **  *             *             

A0A673WET2_BCL2L11      cagatg------caccaaga---------------------gcccgcctt
A0A673XGV4_BCL2L11      cacatg------caccaaga---------------------gcccgcctt
A0A673YQV3_BMF-01       cccttgtggaggcgcctgg-----------cctcggctctgctcaccctg
A0A674EF64_BMF-01       cccttgtggtggcgcctgg-----------cctcagctctgttcaccctg
A0A674DKC6_BAD-01       tgcgggagcagccaaacagatgaccaagtccccc--agctggtgggccta
A0A673ZHY7_BAD-01       cccaggaggggtcaagcagg-----aggtctcccgaggatggttctcttt
A0A674AVP9_BAD-01       tccaagaggaggcaagcaga-----aagtctcccgaggatggttctcttt
                             *      *     *                           * * 

A0A673WET2_BCL2L11      cctactgtggatggggctcctgattggacgactattacagatcatcctgc
A0A673XGV4_BCL2L11      cctactgtggatgagtcttctgattggacgactattacagataatcctgc
A0A673YQV3_BMF-01       ctgtttgagcaggaggccatcgctggaggggagagagcagg---------
A0A674EF64_BMF-01       ctgtttgagcaggaggccatcgctggaagggggagagcagg---------
A0A674DKC6_BAD-01       cctgttcag----------tcataaggagacag-agacagaacatacccc
A0A673ZHY7_BAD-01       cctctggag----------tccaaaaaaggctgaaggcagg---------
A0A674AVP9_BAD-01       cctctggag----------tccaaaggaggcggaaggcagg---------
                        *       *                            ***          

A0A673WET2_BCL2L11      a-----------------gagaagatga
A0A673XGV4_BCL2L11      g-----------------gagaagatga
A0A673YQV3_BMF-01       ------------------gtggaggtga
A0A674EF64_BMF-01       ------------------gtggaggtga
A0A674DKC6_BAD-01       taccatcccaccacgatcatctgagtag
A0A673ZHY7_BAD-01       ----------------------gagtga
A0A674AVP9_BAD-01       ----------------------gagtga
                                                 *  

© 1998-2020Legal notice