Dataset for CDS classical BH3-containing proteins of organism Rhinolophus ferrumequinum

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A671DWL6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaagagctggaggatgatgtgtttcagccagaggatggggatctggggacccagcctgg
gagcttgccctctgctgacctgtttgctcagagccagctggactgccccctcagccgtctgcagctcttccctctcaccc
actgctgtggccctgggctgcgacccaccagccaggaagacaaggccacccagacgctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttacctcttggcgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaagcttcagtgtattgcagaccagttccaccggcttcatatgcagcaacaccagcagaaccgaaatcgggtgtgg
tggcagatcctcctgttcctacacaacctcgctttgaatggagatgagaaccggaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A671DWL6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BMF (length=582 residues).
atgccttattatgccctaacaggggagatggagccgcctcagtgtgtggaagagctggaggatgatgtgtttcagccaga
ggatggggatctggggacccagcctgggagcttgccctctgctgacctgtttgctcagagccagctggactgccccctca
gccgtctgcagctcttccctctcacccactgctgtggccctgggctgcgacccaccagccaggaagacaaggccacccag
acgctcagtccagcctccccaagccagggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgg
caatgctggctaccggctccctctccctgccagtttccctgcaggcttacctcttggcgagcagccccctgaagggcagt
ggcaacatcgagcagagatacagattgcccgaaagcttcagtgtattgcagaccagttccaccggcttcatatgcagcaa
caccagcagaaccgaaatcgggtgtggtggcagatcctcctgttcctacacaacctcgctttgaatggagatgagaaccg
gaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A671ELU4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggagaccagcccccaggcccaggcaagcacctgtgtacggccccgggcctcctgggggaagctggtcaccaacagggac
agccagccagcagcagccaccatggaggcgctgggtctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaggaagatgaagagatggaggaggaggagcccagccccttccggggccgctcgcgctcagcgccccccaacctctgggc
tgcacagcgctatggccgagagctccggaggatgagcgatgagttcgagggttcctttaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaaactccagctggacacgcatcttccagtccttgtggagaggaggctccgcc
tcctcccaatga
>gnl|bcl2dbcds|A0A671EYM5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=PMAIP1 (length=360 residues).
gtgggctcttgcttctccccagaacccgaggttctcggctacccactgagtgccgtctccagccggctcccatcaggtcc
agcccgcccgcctggcgcgcagctcgcgtcctgtagaccccagggtgcaacccaaggttgggggactgagttccccggag
gtctgcaacagacttcccgccggctgctcgcggagatgcctggaaagaaggcgcgtaagaacgcgcagccgagccccacg
cgggccccggcagagctcgaagttgagtgtgccattcaattcaggagaattggagacaaactgagtttccggcagaaact
tctgaatctaatatccaaactcttccgctcaggaacctga
>gnl|bcl2dbcds|A0A671EZ71_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccagccgtgtgcgcctgcagtgcaggccgcctgggtctgcgctc
gtccgcggcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A671F3X5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BBC3 (length=780 residues).
agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggcttccttctggttgggtcccccatcagatttg
tggccccagggagcgccatggcccgagcactccaggagggcagctccccggagcccgtagagggcctggcccgcgacggc
ccgcgccccttcccactcagccgcctggtgccctcggctgtgtcctgcggcctctgcgagccaggcctgcccgctgcccc
cgccgcccctgccctgctgccagctgcctacctctgcgcccccacagccccgcccaccgtcacctccaccctggggggcc
cccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcacccgcggag
cagcacctggaatcgccggtgcccagcgccccgggtgccctggcgggcggccccacccacgcagccccgggagtccgggg
ggaggaggagcagtgggcccgagagatcggggcccagctgcggcgaatggcggacgacctcgacgcactgtacgagcggc
ggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaacctgatcatgggactgctgccctta
cccaggggccgtggagcccccgagatggagcccaattaggtgcctgcacccgcacggtggacgtcagggacttggggggc
aggaccctcccacctcctgacgccctggccagcgcgggggacattttctgcaccatgtag
>gnl|bcl2dbcds|A0A671F3X5_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BBC3 (length=390 residues).
agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggcttccttctggttgggtcccccatcagatttg
tggtcctcagccctcactctcacccgcggagcagcacctggaatcgccggtgcccagcgccccgggtgccctggcgggcg
gccccacccacgcagccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgaatg
gcggacgacctcgacgcactgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcct
gtacaacctgatcatgggactgctgcccttacccaggggccgtggagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A671F3X5_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BBC3 (length=300 residues).
agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggcttccttctggttgggtcccccatcagatttg
tgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaacctgatcatgggactgctgccctta
cccaggggccgtggagcccccgagatggagcccaattaggtgcctgcacccgcacggtggacgtcagggacttggggggc
aggaccctcccacctcctgacgccctggccagcgcgggggacattttctgcaccatgtag
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccgcctgccagccccgggccttttgccaccagatccccgctcttcatctttgtgaga
agatcctccctgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
aggccctccccgcggacctgcgcccggagatctggatcgcacaggagcttcggcggatcggggacgagttcaacgcctgt
tacccacggagggtcttcctgaataattaccgagcagcgggagcccacccgcggatggcggtcatacggctgttgcgtta
catcctccgtctgttgtggaggatgcagtga
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccgcctgccagccccgggccttttgccaccagatccccgctcttcatctttgtgaga
agatcctccctgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatgggtcttcctgaataa
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=471 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatggcctcccggcggcagccccaggccctc
cccgcggacctgcgcccggagatctggatcgcacaggagcttcggcggatcggggacgagttcaacgcctgttacccacg
gagggcccgcttcgtacttgggtcccacacagaagtgcctggaattgaagcagagaagaaaggggctcgcactgcggttc
tggctggcttgtatccacgttcgcgttttcatgtgctccgtgtgaccctgacattttttcgtgctgcctga
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccgcctgccagccccgggccttttgccaccagatccccgctcttcatctttgtgaga
agatcctccctgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
aggccctccccgcggacctgcgcccggagatctggatcgcacaggagcttcggcggatcggggacgagttcaacgcctgt
tacccacggaggttcgggcagtag
© 1998-2020Legal notice