Dataset for CDS classical BH3-containing proteins of organism Rhinolophus ferrumequinum

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671DWL6_BMF-01       ---------------------------atggagccgcctcagtgtgtgga
A0A671DWL6_BMF-02       atgccttattatgccctaacaggggagatggagccgcctcagtgtgtgga
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A671FCV3_BCL2L11      atggcaaagcaacctt-----------ccgatgcaagttctgagtgtgac
A0A671FCV3_BCL2L11      atggcaaagcaacctt-----------ccgatgcaagttctgagtgtgac
A0A671FCV3_BCL2L11      atggcaaagcaacctt-----------ccgatgcaagttctgagtgtgac
A0A671FCV3_BCL2L11      atggcaaagcaacctt-----------ccgatgcaagttctgagtgtgac
A0A671ELU4_BAD-01       atgttccag----atc-----------ccagagtttgagcagag--tgag
A0A671EZ71_HRK-01       ------------------------------------atg-------tgcc
A0A671F3X5_BBC3-03      -----------------------------agagtcagtgcaggggctgcc
A0A671F3X5_BBC3-01      -----------------------------agagtcagtgcaggggctgcc
A0A671F3X5_BBC3-02      -----------------------------agagtcagtgcaggggctgcc
                                                                          

A0A671DWL6_BMF-01       agagctggaggatgatgtgtttcagccagaggatg---------gggatc
A0A671DWL6_BMF-02       agagctggaggatgatgtgtttcagccagaggatg---------gggatc
A0A671EYM5_PMAIP1-      ---gtgggc-----------tcttgc----------ttctccccagaacc
A0A671FCV3_BCL2L11      agagaaggtggacaattgcagcctgctgagagaccgcctcagctcaggcc
A0A671FCV3_BCL2L11      agagaaggtggacaattgcagcctgctgagagaccgcctcagctcaggcc
A0A671FCV3_BCL2L11      agagaaggtggacaattgcagcctgctgagagaccgcctcagctcaggcc
A0A671FCV3_BCL2L11      agagaaggtggacaattgcagcctgctgagagaccgcctcagctcaggcc
A0A671ELU4_BAD-01       caggaagac-----------tccagcc---------ctgcagataggggc
A0A671EZ71_HRK-01       cgtgc---c-----------ccctgca---------c-------cgcggc
A0A671F3X5_BBC3-03      cgggcatgt-----------ccatgc----------c-------aggtgc
A0A671F3X5_BBC3-01      cgggcatgt-----------ccatgc----------c-------aggtgc
A0A671F3X5_BBC3-02      cgggcatgt-----------ccatgc----------c-------aggtgc
                           *                    **                       *

A0A671DWL6_BMF-01       tggggacccagcctgggagcttgccctctgctga-------------cct
A0A671DWL6_BMF-02       tggggacccagcctgggagcttgccctctgctga-------------cct
A0A671EYM5_PMAIP1-      cgaggttct---------------cggctaccca--------------ct
A0A671FCV3_BCL2L11      cggggctcc----------------gacctctgt--------------ac
A0A671FCV3_BCL2L11      cggggctcc----------------gacctctgt--------------ac
A0A671FCV3_BCL2L11      cggggctcc----------------gacctctgt--------------ac
A0A671FCV3_BCL2L11      cggggctcc----------------gacctctgt--------------ac
A0A671ELU4_BAD-01       ctgggccccagccccacaggagaccagcccccaggcccaggcaagcacct
A0A671EZ71_HRK-01       cgcgg---c------------------cccccag--------------cc
A0A671F3X5_BBC3-03      cgaggcttc------------------cttctgg--------------tt
A0A671F3X5_BBC3-01      cgaggcttc------------------cttctgg--------------tt
A0A671F3X5_BBC3-02      cgaggcttc------------------cttctgg--------------tt
                           **                      *  *                   

A0A671DWL6_BMF-01       gtttgctcagagccagctggactgc-------------------------
A0A671DWL6_BMF-02       gtttgctcagagccagctggactgc-------------------------
A0A671EYM5_PMAIP1-      gagtgc-----cgtctccag------------------------------
A0A671FCV3_BCL2L11      agatag-----agcggca--------------------------------
A0A671FCV3_BCL2L11      agatag-----agcggcaaggtaat-------------------------
A0A671FCV3_BCL2L11      agatag-----agcggcaaggtaat-------------------------
A0A671FCV3_BCL2L11      agatag-----agcggcaaggtaat-------------------------
A0A671ELU4_BAD-01       gtgtac-----ggccccgggcctcc-------------------------
A0A671EZ71_HRK-01       gtgtgc-----gcctgcag---tgc-------------------------
A0A671F3X5_BBC3-03      gggtcc-----cccatcagatttgt-------------------------
A0A671F3X5_BBC3-01      gggtcc-----cccatcagatttgtggccccagggagcgccatggcccga
A0A671F3X5_BBC3-02      gggtcc-----cccatcagatttgt-------------------------
                           *            *                                 

A0A671DWL6_BMF-01       --------------------------------------------------
A0A671DWL6_BMF-02       --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       --------------------------------------------------
A0A671EZ71_HRK-01       --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      gcactccaggagggcagctccccggagcccgtagagggcctggcccgcga
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671DWL6_BMF-01       --------------------------------------------------
A0A671DWL6_BMF-02       --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       --------------------------------------------------
A0A671EZ71_HRK-01       --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cggcccgcgccccttcccactcagccgcctggtgccctcggctgtgtcct
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671DWL6_BMF-01       --------------------------------------------------
A0A671DWL6_BMF-02       --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       --------------------------------------------------
A0A671EZ71_HRK-01       --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      gcggcctctgcgagccaggcctgcccgctgcccccgccgcccctgccctg
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671DWL6_BMF-01       --------------------------------------------------
A0A671DWL6_BMF-02       --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       --------------------------------------------------
A0A671EZ71_HRK-01       --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ctgccagctgcctacctctgcgcccccacagccccgcccaccgtcacctc
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671DWL6_BMF-01       --------------------------------------------------
A0A671DWL6_BMF-02       --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       --------------------------------------------------
A0A671EZ71_HRK-01       --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      caccctggggggcccccgctggcctgggggtccccgcagccggccccgag
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671DWL6_BMF-01       ---------------------cccctcagccgtctgcagctcttccctct
A0A671DWL6_BMF-02       ---------------------cccctcagccgtctgcagctcttccctct
A0A671EYM5_PMAIP1-      -------------------ccggctcccatcaggtccagcccgcccgc--
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      -------------------cctgaaggtgaaggggaccgctgccc--cca
A0A671FCV3_BCL2L11      -------------------cctgaaggtgaaggggaccgctgccc--cca
A0A671FCV3_BCL2L11      -------------------cctgaaggtgaaggggaccgctgccc--cca
A0A671ELU4_BAD-01       ----------tgggggaagctggtcaccaacagggacagccagccagcag
A0A671EZ71_HRK-01       -------------aggccgcctgggtctgcgctcgtccgcggcgcagc--
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      gcccgcgccccgacggtcctcagccctcactctcacccgcggagcagcac
A0A671F3X5_BBC3-02      --------------ggtcctcagccctcactctcacccgcggagcagcac
                                                                          

A0A671DWL6_BMF-01       cacccactgctgtggccctgggctgcgacccaccagccaggaagacaagg
A0A671DWL6_BMF-02       cacccactgctgtggccctgggctgcgacccaccagccaggaagacaagg
A0A671EYM5_PMAIP1-      ---------ctggcgcgcagc-----------------------tcgcgt
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      cggcagccctcagggcccgctggccccgcctgccagccccgggccttttg
A0A671FCV3_BCL2L11      cggcagccctcagggcccgctggccccgcctgccagccccgggccttttg
A0A671FCV3_BCL2L11      cggcagccctcagggcccgctggccccgcctgccagccccgggccttttg
A0A671ELU4_BAD-01       cagccaccatggaggcgctgggtctgtggagccccg--gagtcgccacag
A0A671EZ71_HRK-01       ------tcaccgccgcccggc-----------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ctggaatcgccggtgcccagcgccccgggtgccctggcgggcggccccac
A0A671F3X5_BBC3-02      ctggaatcgccggtgcccagcgccccgggtgccctggcgggcggccccac
                                                                          

A0A671DWL6_BMF-01       ccacccagacgctcagtccagcctccccaa--------------------
A0A671DWL6_BMF-02       ccacccagacgctcagtccagcctccccaa--------------------
A0A671EYM5_PMAIP1-      cctgtagaccccagggtgcaacccaa------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      ccaccagatccccgctcttcatctttgtgagaagatcctccctgctgtcc
A0A671FCV3_BCL2L11      ccaccagatccccgctcttcatctttgtgagaagatcctccctgctgtcc
A0A671FCV3_BCL2L11      ccaccagatccccgctcttcatctttgtgagaagatcctccctgctgtcc
A0A671ELU4_BAD-01       ctcgtaccccgcggggaccgaggaagatgaagag-------atggag---
A0A671EZ71_HRK-01       -----------------------------------------tcaagg---
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ccacgcagccccgggagtccggggggaggaggagcagtgggcccgag---
A0A671F3X5_BBC3-02      ccacgcagccccgggagtccggggggaggaggagcagtgggcccgag---
                                                                          

A0A671DWL6_BMF-01       --------------------------------gccagggtgtcatgctgc
A0A671DWL6_BMF-02       --------------------------------gccagggtgtcatgctgc
A0A671EYM5_PMAIP1-      --------------------------------ggttgggggactgagttc
A0A671FCV3_BCL2L11      --------------------------------agacaggagcccagc---
A0A671FCV3_BCL2L11      cgctcctccagtgggtatttctcttttgacacagacaggagcccagc---
A0A671FCV3_BCL2L11      cgctcctccagtgggtatttctcttttgacacagacaggagcccagc---
A0A671FCV3_BCL2L11      cgctcctccagtgggtatttctcttttgacacagacaggagcccagc---
A0A671ELU4_BAD-01       --------------------------------gaggaggagcccagcccc
A0A671EZ71_HRK-01       --------------------------------cgctcggcgacgagctgc
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------agatcggggcccagctgc
A0A671F3X5_BBC3-02      --------------------------------agatcggggcccagctgc
                                                                          

A0A671DWL6_BMF-01       cttgtggggtg--------------------------------actgagg
A0A671DWL6_BMF-02       cttgtggggtg--------------------------------actgagg
A0A671EYM5_PMAIP1-      -------------------------------------------cccggag
A0A671FCV3_BCL2L11      -------------------------------------------acccatg
A0A671FCV3_BCL2L11      -------------------------------------------acccatg
A0A671FCV3_BCL2L11      -------------------------------------------acccatg
A0A671FCV3_BCL2L11      -------------------------------------------acccatg
A0A671ELU4_BAD-01       ttccggggccgctcgcgctcagcgcccccca------------acctctg
A0A671EZ71_HRK-01       -------------------------------------------accagcg
A0A671F3X5_BBC3-03      ----------------------------------------gagacaagag
A0A671F3X5_BBC3-01      ggcgaatggcggacgacctcgacgcactgtacgagcggcggagacaagag
A0A671F3X5_BBC3-02      ggcgaatggcggacgacctcgacgcactgtacgagcggcggagacaagag
                                                                    *    *

A0A671DWL6_BMF-01       aaccccag-----cgactcttttatggcaatgctggctaccggctccctc
A0A671DWL6_BMF-02       aaccccag-----cgactcttttatggcaatgctggctaccggctccctc
A0A671EYM5_PMAIP1-      gtctgcaa-----caga------------------cttcccgccggctgc
A0A671FCV3_BCL2L11      agttgtgacaaatcaac------------------acaaacgccgagtcc
A0A671FCV3_BCL2L11      agttgtgacaaatcaac------------------acaaacgccgagtcc
A0A671FCV3_BCL2L11      agttgtgacaaatcaac------------------acaaacgccgagtcc
A0A671FCV3_BCL2L11      agttgtgacaaatcaac------------------acaaacgccgagtcc
A0A671ELU4_BAD-01       ggctgca------cagc------------------gctatggccgagagc
A0A671EZ71_HRK-01       caccatg------tggc------------------ggcgccgcgcgcgga
A0A671F3X5_BBC3-03      gagca-g------cagc------------------gacaccgcccctcgc
A0A671F3X5_BBC3-01      gagca-g------cagc------------------gacaccgcccctcgc
A0A671F3X5_BBC3-02      gagca-g------cagc------------------gacaccgcccctcgc
                                                                 *        

A0A671DWL6_BMF-01       tccctgccagtttccctgcaggcttacctcttggcgagcagccccctgaa
A0A671DWL6_BMF-02       tccctgccagtttccctgcaggcttacctcttggcgagcagccccctgaa
A0A671EYM5_PMAIP1-      tcgcggagat--gcct---------------ggaaagaaggcgcgtaaga
A0A671FCV3_BCL2L11      tccttgccag--gccttcaaccattatctcagtgcaatggcctcccggcg
A0A671FCV3_BCL2L11      tccttgccag--gccttcaaccattatctcagtgcaatggcctcccggcg
A0A671FCV3_BCL2L11      tccttgccag--gccttcaaccattatctcagtgcaatggcctcccggcg
A0A671FCV3_BCL2L11      tccttgccag--gccttcaaccattatctcagtgcaat------------
A0A671ELU4_BAD-01       tcc--ggagg--a---t--------------gagcgatgagttcgagggt
A0A671EZ71_HRK-01       gcc--ggagg--gcgcc--------------g-gcgcccgg---------
A0A671F3X5_BBC3-03      cct--ggagg--gtcct--------------gtacaacctgatcatggga
A0A671F3X5_BBC3-01      cct--ggagg--gtcct--------------gtacaacctgatcatggga
A0A671F3X5_BBC3-02      cct--ggagg--gtcct--------------gtacaacctgatcatggga
                         *   *                                            

A0A671DWL6_BMF-01       gggcagtggcaacatc-------------gagcagagatacagattgccc
A0A671DWL6_BMF-02       gggcagtggcaacatc-------------gagcagagatacagattgccc
A0A671EYM5_PMAIP1-      acgcgcagccgagccccacgc-----------------------------
A0A671FCV3_BCL2L11      gcagccccaggccctccccgcggacctgcgcccggagatctggatcgcac
A0A671FCV3_BCL2L11      gcagccccaggccctccccgcggacctgcgcccggagatctggatcgcac
A0A671FCV3_BCL2L11      gcagccccaggccctccccgcggacctgcgcccggagatctggatcgcac
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       tcctttaagggacttcctcgc-----------------------------
A0A671EZ71_HRK-01       -c--------gcgctccccac-----------------------------
A0A671F3X5_BBC3-03      ct--------gctgcccttac-----------------------------
A0A671F3X5_BBC3-01      ct--------gctgcccttac-----------------------------
A0A671F3X5_BBC3-02      ct--------gctgcccttac-----------------------------
                                                                          

A0A671DWL6_BMF-01       gaaagcttcagtgtattgcagaccagttccacc----ggcttcatatgca
A0A671DWL6_BMF-02       gaaagcttcagtgtattgcagaccagttccacc----ggcttcatatgca
A0A671EYM5_PMAIP1-      ------------gggccccggcagagctcgaag------ttgagtgtgcc
A0A671FCV3_BCL2L11      aggagcttcggcggatcggggacgagttcaacgcctgttacccacggagg
A0A671FCV3_BCL2L11      aggagcttcggcggatcggggacgagttcaacgcctgttacccacggagg
A0A671FCV3_BCL2L11      aggagcttcggcggatcggggacgagttcaacgcctgttacccacggagg
A0A671FCV3_BCL2L11      ------------------------------------------------gg
A0A671ELU4_BAD-01       --------ccgaagagcgcgg----gcacagcg------acgcagatgcg
A0A671EZ71_HRK-01       --------ctactggccctggctgtgcgcggcc------gcgcaggtggc
A0A671F3X5_BBC3-03      --------ccaggggccgtgg--------agcc------cccgagatgga
A0A671F3X5_BBC3-01      --------ccaggggccgtgg--------agcc------cccgagatgga
A0A671F3X5_BBC3-02      --------ccaggggccgtgg--------agcc------cccgagatgga
                                                                          

A0A671DWL6_BMF-01       gcaacacc-----------------------------------------a
A0A671DWL6_BMF-02       gcaacacc-----------------------------------------a
A0A671EYM5_PMAIP1-      attcaatt----------------------------------------ca
A0A671FCV3_BCL2L11      gcccgcttcgtacttgggtcccacacagaagtgcctggaattgaagcaga
A0A671FCV3_BCL2L11      ttc-----------------------------------------------
A0A671FCV3_BCL2L11      gtcttcct------------------------------gaataattaccg
A0A671FCV3_BCL2L11      gtcttcct------------------------------gaataa------
A0A671ELU4_BAD-01       gcaaaact------------------------------------------
A0A671EZ71_HRK-01       ggc-----------------------------------------------
A0A671F3X5_BBC3-03      gcccaattaggtgcctgcacccgcacggtggacgtcagggacttgggggg
A0A671F3X5_BBC3-01      gcccaattaggtgcctgcacccgcacggtggacgtcagggacttgggggg
A0A671F3X5_BBC3-02      gcccaattag----------------------------------------
                                                                          

A0A671DWL6_BMF-01       gcagaaccgaaatcgggtgtggtggcagatcctcctgttcctacacaacc
A0A671DWL6_BMF-02       gcagaaccgaaatcgggtgtggtggcagatcctcctgttcctacacaacc
A0A671EYM5_PMAIP1-      ggagaattggagacaaactgagtttccggcagaaacttctgaatctaata
A0A671FCV3_BCL2L11      gaagaaaggggctcgcactgcggttctggctggcttgtatccacgttcgc
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      agcagcgggagcccacccgcggatggcggtcatacggctgttgcgttaca
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671ELU4_BAD-01       -----------------------------ccagctgg----------aca
A0A671EZ71_HRK-01       ----------------gctggcggcctggct-gctcg----------gca
A0A671F3X5_BBC3-03      caggaccctcccacctcctgacgccctggccagcgcg----------ggg
A0A671F3X5_BBC3-01      caggaccctcccacctcctgacgccctggccagcgcg----------ggg
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671DWL6_BMF-01       tcgctttgaatggagatgagaaccggaacggggcaggtcccaggtga-
A0A671DWL6_BMF-02       tcgctttgaatggagatgagaaccggaacggggcaggtcccaggtga-
A0A671EYM5_PMAIP1-      tccaaactcttccgctcaggaacctga---------------------
A0A671FCV3_BCL2L11      gttttcatgtgctccgtgtgaccctgacattttttcgtgctgcctga-
A0A671FCV3_BCL2L11      --------------------gggcag------------------tag-
A0A671FCV3_BCL2L11      tcctccgtctgttgtggaggatgcag------------------tga-
A0A671FCV3_BCL2L11      ------------------------------------------------
A0A671ELU4_BAD-01       cgcatcttccagtccttgtggagaggaggctccgcctcctcccaatga
A0A671EZ71_HRK-01       ggc-------ggaacttgtag---------------------------
A0A671F3X5_BBC3-03      gacattttctgcaccatgtag---------------------------
A0A671F3X5_BBC3-01      gacattttctgcaccatgtag---------------------------
A0A671F3X5_BBC3-02      ------------------------------------------------
                                                                        

© 1998-2020Legal notice