Dataset for CDS classical BH3-containing proteins of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

24 sequence(s)

>gnl|bcl2dbcds|A0A2R8VI69_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|A0A2R8VI69_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|A0A2R8VI69_BIK-03 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=429 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggg
>gnl|bcl2dbcds|A0A2R8VI69_BIK-04 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=321 residues).
atgttcaccagaaaccaggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtct
ggtccagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagct
tgattcgaagcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgac
caggaccctgggcagctgtttccgatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtg
a
>gnl|bcl2dbcds|A0A494BAM9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=312 residues).
atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggcagagctaccacctgagttcgcagctcaact
caggaagatcggagacaaagtgtattgcacgtggagtgcaccggacataactgtggttctggcgcagatgcctgggaagt
cgcaaaagagcaggatgaggagcccaagcccaacccgggtgccagcagacttgaaggacgagtgtgctcaactccggagg
attggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaacctga
>gnl|bcl2dbcds|A0A494BAM9_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=156 residues).
atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggcagacttgaaggacgagtgtgctcaactccg
gaggattggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaacctga
>gnl|bcl2dbcds|A0A494BAM9_PMAIP1-03 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=165 residues).
atgcctgggaagtcgcaaaagagcaggatgaggagcccaagcccaacccgggtgccagcagacttgaaggacgagtgtgc
tcaactccggaggattggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaa
cctga
>gnl|bcl2dbcds|A0A494BBC4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=615 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtgctacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggcgcaggggctatggagactcg
gagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatggaggaggagcttagcccttttcgaggacgct
cgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagcgccggctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccctcccagtga
>gnl|bcl2dbcds|A0A494BBC4_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=537 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtgctacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggcgcaggggctatggagactcg
gagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatggaggaggagcttagcccttttcgaggacgct
cgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggagaagagctgacgtacagcttgagtcccttccggtgcgtgcaatag
>gnl|bcl2dbcds|A0A494BBC4_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacac
agatgcgacaaagcgccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccc
tcccagtga
>gnl|bcl2dbcds|A0A494BBC4_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacac
agatgcgacaaagcgccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccc
tcccagtga
>gnl|bcl2dbcds|A0A494BBC4_BAD-05 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=396 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaaggtgagcgccagcgttaggtgcgatgggacctga
>gnl|bcl2dbcds|A0A494BBC4_BAD-06 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacac
agatgcgacaaagcgccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccc
tcccagtga
>gnl|bcl2dbcds|A0A494BBC4_BAD-07 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=485 residues).
tccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcactgag
gaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaacagtca
tcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatgg
aggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgag
ctccgaaggatgagcgatgagtttgagggttccttcaagagcatgctgggacttgcagttctaatccgtcctctctcagt
gtccagtgatttgctgggatttcctccctcttcctcctttgtccaagaccccgtccccagtcccggtttatgccttcacc
tgtaa
>gnl|bcl2dbcds|A0A494BBC4_BAD-09 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=190 residues).
ggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggttccttcaagtttcatttaggatccc
ggcacacgcatcatcccgtgtctctgaccgcccagtgcagagcaagctggtggtggggacctgattcgggatgccagaat
gaggctcactctttcctcctccttccctga
>gnl|bcl2dbcds|A2AV74_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=816 residues).
atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtggcctcctcccgcgccagctcgcgcctgcagc
agtcgctgccgcagcccgcgccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatcgagtgtgggc
accaagccccccgagtgttcttcaccctggaccctggcgcagagccctggcatcacaactcggaggctgagacgctgtcc
tggagtcacccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatgggga
gccagggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactcc
agctcttccctctcacccattgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctgg
ctacaggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagc
accgagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
ggtggggccctggtga
>gnl|bcl2dbcds|A2AV74_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=573 residues).
atgtccccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagcc
agggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactccagc
tcttccctctcacccattgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtcca
gcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggcta
caggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcacc
gagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcag
aaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggt
ggggccctggtga
>gnl|bcl2dbcds|A2AV74_BMF-06 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagccagggacacagcctgg
gggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactccagctcttccctctcaccc
attgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtccagcttccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcaga
tcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcagaaccgagaccgtgcg
tggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggtggggccctggtga
>gnl|bcl2dbcds|B2RVL4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|Q6PEB3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaact
tacacaaggagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctt
tatcttccgtctggtatggagaaggcattga
>gnl|bcl2dbcds|Q6PEB3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=276 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatcagttggagaatcttaaccaagtg
gcacaaaatatccacggtgatgcctggtacaactga
>gnl|bcl2dbcds|Q6PEB3_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctcaggaggaa
cctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaag
gagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttcc
gtctggtatggagaaggcattga
>gnl|bcl2dbcds|Q6PEB3_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=333 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagcttccatacgacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtgttt
gcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttccgtctggtatg
gagaaggcattga
>gnl|bcl2dbcds|Q6PEB3_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=333 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagcttccatacgacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtgttt
gcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttccgtctggtatg
gagaaggcattga
© 1998-2022Legal notice