Dataset for CDS classical BH3-containing proteins of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

28 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggctt
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggctt
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          gaggaagtccgatcccggaatccggagcctggggagcgacgcgggaggaa
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          gaggaagtccgatcccggaatccggagcctggggagcgacgcgggaggaa
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------atggccaagc--------------
O54918_BCL2L11-01      --------------------------atggccaagc--------------
O54918_BCL2L11-05      --------------------------atggccaagc--------------
O54918_BCL2L11-06      --------------------------atggccaagc--------------
O54918_BCL2L11-08      --------------------------atggccaagc--------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          ------------------------------tccagatcccagagtttgag
Q61337_BAD-02          ggcggtggagaccagcagcccagagtatgttccagatcccagagtttgag
Q61337_BAD-05          --------------------------atgttccagatcccagagtttgag
Q61337_BAD-01          ggcggtggagaccagcagcccagagtatgttccagatcccagagtttgag
Q61337_BAD-03          --------------------------atgttccagatcccagagtttgag
Q61337_BAD-04          --------------------------atgttccagatcccagagtttgag
Q61337_BAD-06          --------------------------atgttccagatcccagagtttgag
Q9JM54_PMAIP1-03       --------------------------atgcctggga--------------
Q9JM54_PMAIP1-01       --------------------------atgcccgggag-------------
Q9JM54_PMAIP1-02       --------------------------atgcccgggag-------------
P62816_HRK-03          --------------------------atgt--------------------
O70337_BIK-04          --------------------------atgtt-------------------
O70337_BIK-01          --------------------------atgtcggaggcgagacttatggcc
O70337_BIK-02          --------------------------atgtcggaggcgagacttatggcc
O70337_BIK-03          --------------------------atgtcggaggcgagacttatggcc
B2RVL4_BBC3-01         --------------------------atggcccgcgcacgcc--------
Q99ML1_BBC3-01         --------------------------atggcccgcgcacgcc--------
Q99ML1_BBC3-02         --------------------------atggcccgcgcacgcc--------
Q99ML1_BBC3-03         --------------------------atggcccgcgcacgcc--------
Q91ZE9_BMF-02          --------------------------atgtc-------------------
Q91ZE9_BMF-01          --------------------------atgcccggagcgggcgtattttgg
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q61337_BAD-02          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q61337_BAD-05          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q61337_BAD-01          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q61337_BAD-03          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q61337_BAD-04          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q61337_BAD-06          ccgagtgagcaggaagacgctagtgctacagataggggcctgggccctag
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          agagacgtcatcaagactgttcc---------------------------
O70337_BIK-02          agagacgtcatcaagactgttcc---------------------------
O70337_BIK-03          agagacgtcatcaagactgttcc---------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          aaacaataccgcgcggtgtgccgtggcctcctcccgcgccagctcgcgcc
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          cctcactgaggacc------------------------------------
Q61337_BAD-02          cctcactgaggacc------------------------------------
Q61337_BAD-05          cctcactgaggacc------------------------------------
Q61337_BAD-01          cctcactgaggacc------------------------------------
Q61337_BAD-03          cctcactgaggacc------------------------------------
Q61337_BAD-04          cctcactgaggacc------------------------------------
Q61337_BAD-06          cctcactgaggacc------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          tgcagcagtcgctgccgcagcccgcgccaccgcctcccaccgcagcccgc
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          tggagtttgcccccttcttcccaatcgagtgtgggcaccaagccccccga
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          gtgttcttcaccctggaccctggcgcagagccctggcatcacaactcgga
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          ----------------------------------agccaggtccctacct
Q61337_BAD-02          ----------------------------------agccaggtccctacct
Q61337_BAD-05          ----------------------------------agccaggtccctacct
Q61337_BAD-01          ----------------------------------agccaggtccctacct
Q61337_BAD-03          ----------------------------------agccaggtccctacct
Q61337_BAD-04          ----------------------------------agccaggtccctacct
Q61337_BAD-06          ----------------------------------agccaggtccctacct
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       ----------------------------------aaaggcgcgtcggaac
Q9JM54_PMAIP1-02       ----------------------------------aaaggcgcgtcggaac
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          -----------------------------------cac------------
O70337_BIK-01          ----------------------------------acacgaccaggtcccc
O70337_BIK-02          ----------------------------------acacgaccaggtcccc
O70337_BIK-03          ----------------------------------acacgaccaggtcccc
B2RVL4_BBC3-01         ----------------------------------aggagggcagctctcc
Q99ML1_BBC3-01         ----------------------------------aggagggcagctctcc
Q99ML1_BBC3-02         ----------------------------------aggagggcagctctcc
Q99ML1_BBC3-03         ----------------------------------aggagggcagctctcc
Q91ZE9_BMF-02          ------------------------cccaggagagatggagccacctc---
Q91ZE9_BMF-01          ggctgagacgctgtcctggagtcacccaggagagatggagccacctc---
Q91ZE9_BMF-06          ----------------------------------atggagccacctc---

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q61337_BAD-02          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q61337_BAD-05          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q61337_BAD-01          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q61337_BAD-03          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q61337_BAD-04          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q61337_BAD-06          ggccccaggtctcctggggagcaacattcatcagcagggacgggcagcca
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       gcgccagtgaacccaacgcgggcagagctaccacctgagttcgcagctca
Q9JM54_PMAIP1-02       gcgccagtgaacccaacgcgg-----------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          caacctccagtggcctctgagactcccagcatgaaggagcctgtgagaga
O70337_BIK-02          caacctccagtggcctctgagactcccagcatgaaggagcctgtgagaga
O70337_BIK-03          caacctccagtggcctctgagactcccagcatgaaggagcctgtgagaga
B2RVL4_BBC3-01         ggagc-----------------------ccgtagagggtctagcccgcga
Q99ML1_BBC3-01         ggagc-----------------------ccgtagagggtctagcccgcga
Q99ML1_BBC3-02         ggagc-----------------------ccgtagagggtctagcccgcga
Q99ML1_BBC3-03         ggagc-----------------------ccgtagagggtctagcccgcga
Q91ZE9_BMF-02          --agt-----------------------gtgtggaggagctagaagatga
Q91ZE9_BMF-01          --agt-----------------------gtgtggaggagctagaagatga
Q91ZE9_BMF-06          --agt-----------------------gtgtggaggagctagaagatga

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q61337_BAD-02          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q61337_BAD-05          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q61337_BAD-01          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q61337_BAD-03          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q61337_BAD-04          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q61337_BAD-06          ccaacagtcatcatggaggcgcaggggctatggagactcggagtcgccac
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       actcaggaagatcggagacaaagtgtattgcacgtggagtgcaccggaca
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          ---------------------------------------------gcccg
O70337_BIK-04          -----------------------------------cag-----aaaccag
O70337_BIK-01          cgtggacctcatggag--------tgcgtggaaggcag-----aaaccag
O70337_BIK-02          cgtggacctcatggag--------tgcgtggaaggcag-----aaaccag
O70337_BIK-03          cgtggacctcatggag--------tgcgtggaaggcag-----aaaccag
B2RVL4_BBC3-01         -------cagtccgcgccccttcccgctcgg------------ccgcctg
Q99ML1_BBC3-01         -------cagtccgcgccccttcccgctcgg------------ccgcctg
Q99ML1_BBC3-02         -------cagtccgcgccccttcccgctcgg------------ccgcctg
Q99ML1_BBC3-03         -------cagtccgcgccccttcccgctcgg------------ccgcctg
Q91ZE9_BMF-02          tgtgttccagtcagag---------gatggggagccagggacacagcctg
Q91ZE9_BMF-01          tgtgttccagtcagag---------gatggggagccagggacacagcctg
Q91ZE9_BMF-06          tgtgttccagtcagag---------gatggggagccagggacacagcctg

O54918_BCL2L11-03      ------aaccttc--tgatgtaagttctgagtgtgacagagaaggtggac
O54918_BCL2L11-01      ------aaccttc--tgatgtaagttctgagtgtgacagagaaggtggac
O54918_BCL2L11-05      ------aaccttc--tgatgtaagttctgagtgtgacagagaaggtggac
O54918_BCL2L11-06      ------aaccttc--tgatgtaagttctgagtgtgacagagaaggtggac
O54918_BCL2L11-08      ------aaccttc--tgatgtaagttctgagtgtgacagagaaggtggac
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q61337_BAD-02          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q61337_BAD-05          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q61337_BAD-01          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q61337_BAD-03          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q61337_BAD-04          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q61337_BAD-06          agttcgtacc-----cagcggggaccgaggaggatgaagggatggaggag
Q9JM54_PMAIP1-03       ------------------------------agtcgcaaaagagc------
Q9JM54_PMAIP1-01       taactgtggttctggcgcagatgcctgggaagtcgcaaaagagc------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          ------tgtccccggcatcg-------------cggccgcgggccc-ccg
O70337_BIK-04          g-----tggccttgaggctg--gcctgca---tcggcgatgag----atg
O70337_BIK-01          g-----tggccttgaggctg--gcctgca---tcggcgatgag----atg
O70337_BIK-02          g-----tggccttgaggctg--gcctgca---tcggcgatgag----atg
O70337_BIK-03          g-----tggccttgaggctg--gcctgca---tcggcgatgag----atg
B2RVL4_BBC3-01         a-----tgccctc--cgctgtatcctgcagcctttgc---gagc---ccg
Q99ML1_BBC3-01         a-----tgccctc--cgctgtatcctgcagcctttgc---gagc---ccg
Q99ML1_BBC3-02         a-----tgccctc--cgctgtatcctgcagcctttgc---gagc---ccg
Q99ML1_BBC3-03         a-----tgccctc--cgctgtatcctgcagcctttgc---gagc---ccg
Q91ZE9_BMF-02          ggggcttgctctc--tgctg--acctg-----tttgcccagagccagctg
Q91ZE9_BMF-01          ggggcttgctctc--tgctg--acctg-----tttgcccagagccagctg
Q91ZE9_BMF-06          ggggcttgctctc--tgctg--acctg-----tttgcccagagccagctg

O54918_BCL2L11-03      aattgcagcctgctgagaggcctccccagctcaggcctggggcccctacc
O54918_BCL2L11-01      aattgcagcctgctgagaggcctccccagctcaggcctggggcccctacc
O54918_BCL2L11-05      aattgcagcctgctgagaggcctccccagctcaggcctggggcccctacc
O54918_BCL2L11-06      aattgcagcctgctgagaggcctccccagctcaggcctggggcccctacc
O54918_BCL2L11-08      aattgcagcctgctgagaggcctccccagctcaggcctggggcccctacc
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q61337_BAD-02          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q61337_BAD-05          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q61337_BAD-01          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q61337_BAD-03          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q61337_BAD-04          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q61337_BAD-06          gagcttagcccttttcgaggac------gctcgcgttcggctccccccaa
Q9JM54_PMAIP1-03       ------aggatgaggagcccaa------gcccaacccgggtgcca-----
Q9JM54_PMAIP1-01       ------aggatgaggagcccaa------gcccaacccgggtgcca-----
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          gccgtgtg-cggttgcggcgac------gctcgccccgg-----------
O70337_BIK-04          gacctgtgtctgcggagccccc------gtctggtccagctgcctggg-a
O70337_BIK-01          gacctgtgtctgcggagccccc------gtctggtccagctgcctggg-a
O70337_BIK-02          gacctgtgtctgcggagccccc------gtctggtccagctgcctggg-a
O70337_BIK-03          gacctgtgtctgcggagccccc------gtctggtccagctgcctggg-a
B2RVL4_BBC3-01         gcc---tgcccgcc------------------gcccctgctgcccctgcc
Q99ML1_BBC3-01         gcc---tgcccgcc------------------gcccctgctgcccctgcc
Q99ML1_BBC3-02         gcc---tgcccgcc------------------gcccctgctgcccctgcc
Q99ML1_BBC3-03         gcc---tgcccgcc------------------gcccctgctgcccctgcc
Q91ZE9_BMF-02          gac---tgtcccctcagtcgac------tccagctcttccctctcaccca
Q91ZE9_BMF-01          gac---tgtcccctcagtcgac------tccagctcttccctctcaccca
Q91ZE9_BMF-06          gac---tgtcccctcagtcgac------tccagctcttccctctcaccca

O54918_BCL2L11-03      tccctacagacagaaccgca------------------------------
O54918_BCL2L11-01      tccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctg
O54918_BCL2L11-05      tccctacagacagaaccgca------------------------------
O54918_BCL2L11-06      tccctacagacagaaccgca------------------------------
O54918_BCL2L11-08      tccctacagacagaaccgca------------------------------
Q61337_BAD-09          ------ggcagcgcagcgc-------------------------------
Q61337_BAD-07          tctctgggcagcgcagcgc-------------------------------
Q61337_BAD-02          tctctgggcagcgcagcgc-------------------------------
Q61337_BAD-05          tctctgggcagcgcagcgc-------------------------------
Q61337_BAD-01          tctctgggcagcgcagcgc-------------------------------
Q61337_BAD-03          tctctgggcagcgcagcgc-------------------------------
Q61337_BAD-04          tctctgggcagcgcagcgc-------------------------------
Q61337_BAD-06          tctctgggcagcgcagcgc-------------------------------
Q9JM54_PMAIP1-03       --gcagacttgaaggacgag------------------------------
Q9JM54_PMAIP1-01       --gcagacttgaaggacgag------------------------------
Q9JM54_PMAIP1-02       --gcagacttgaaggacgag------------------------------
P62816_HRK-03          --gctgcg---ctgggcggc------------------------------
O70337_BIK-04          ttgctatacacagactcgct------------------------------
O70337_BIK-01          ttgctatacacagactcgct------------------------------
O70337_BIK-02          ttgctatacacagactcgct------------------------------
O70337_BIK-03          ttgctatacacagactcgct------------------------------
B2RVL4_BBC3-01         ttgctg-----ccggccgcc------------------------------
Q99ML1_BBC3-01         ttgctg-----ccggccgcc------------------------------
Q99ML1_BBC3-02         ttgctg-----ccggccgcc------------------------------
Q99ML1_BBC3-03         ttgctg-----ccggccgcc------------------------------
Q91ZE9_BMF-02          ttgctgtggtcccggactcc------------------------------
Q91ZE9_BMF-01          ttgctgtggtcccggactcc------------------------------
Q91ZE9_BMF-06          ttgctgtggtcccggactcc------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      cccccacggcagccctcagggcccgctggccccaccggccagccctggcc
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      cttttgctaccagatccccacttttcatctttgtgagaagatcttctctg
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         --------------------------------------------------
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------agacaggagccc
O54918_BCL2L11-01      ctgtcccggtcctccagtgggtatttctcttttgacacagacaggagccc
O54918_BCL2L11-05      --------------------------------------agacaggagccc
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------tgtgct
Q9JM54_PMAIP1-01       --------------------------------------------tgtgct
Q9JM54_PMAIP1-02       --------------------------------------------tgtgct
P62816_HRK-03          --------------------------------------------ggcgca
O70337_BIK-04          --------------------------------------------gtcacc
O70337_BIK-01          --------------------------------------------gtcacc
O70337_BIK-02          --------------------------------------------gtcacc
O70337_BIK-03          --------------------------------------------gtcacc
B2RVL4_BBC3-01         --------------------------------------------tacctc
Q99ML1_BBC3-01         --------------------------------------------tacctc
Q99ML1_BBC3-02         --------------------------------------------tacctc
Q99ML1_BBC3-03         --------------------------------------------tacctc
Q91ZE9_BMF-02          --------------------------------------------ggccca
Q91ZE9_BMF-01          --------------------------------------------ggccca
Q91ZE9_BMF-06          --------------------------------------------ggccca

O54918_BCL2L11-03      ggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-01      ggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-05      ggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-07          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-02          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-05          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-01          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-03          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-04          tacggccgtg----------------------------agctccgaagga
Q61337_BAD-06          tacggccgtg----------------------------agctccgaagga
Q9JM54_PMAIP1-03       caactccgga----------------------------------------
Q9JM54_PMAIP1-01       caactccgga----------------------------------------
Q9JM54_PMAIP1-02       caactccgga----------------------------------------
P62816_HRK-03          ggtgaccgcg-----------ctgcggctg-------------caggcgc
O70337_BIK-04          tacagccgga--------------caggtgtcagaggtattttcaggagc
O70337_BIK-01          tacagccgga--------------caggtgtcagaggtattttcaggagc
O70337_BIK-02          tacagccgga--------------caggtgtcagaggtattttcaggagc
O70337_BIK-03          tacagccgga--------------caggtgtcagaggtattttcaggagc
B2RVL4_BBC3-01         tgcgccccca--------ccgctccacctgccgtcaccgccgccctg---
Q99ML1_BBC3-01         tgcgccccca--------ccgctccacctgccgtcaccgccgccctg---
Q99ML1_BBC3-02         tgcgccccca--------ccgctccacctgccgtcaccgccgccctg---
Q99ML1_BBC3-03         tgcgccccca--------ccgctccacctgccgtcaccgccgccctg---
Q91ZE9_BMF-02          taagccaggaagacaaggccactcagaccctcagtccagcttccccaagc
Q91ZE9_BMF-01          taagccaggaagacaaggccactcagaccctcagtccagcttccccaagc
Q91ZE9_BMF-06          taagccaggaagacaaggccactcagaccctcagtccagcttccccaagc

O54918_BCL2L11-03      aggccttcaaccacta----------------------------tctcag
O54918_BCL2L11-01      aggccttcaaccactatctcagtgcaatggcttccatacgacagtctcag
O54918_BCL2L11-05      aggccttcaaccactatctcagtgcaatggcttccatacgacagtctcag
O54918_BCL2L11-06      ----------------------------agcttccatacgacagtctcag
O54918_BCL2L11-08      ----------------------------agcttccatacgacagtctcag
Q61337_BAD-09          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-07          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-02          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-05          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-01          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-03          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-04          tgagcgatgagtttga---------------------gggttccttcaag
Q61337_BAD-06          tgagcgatgagtttga---------------------gggttccttcaag
Q9JM54_PMAIP1-03       -ggattggagacaaag---------------------tgaat---ttacg
Q9JM54_PMAIP1-01       -ggattggagacaaag---------------------tgaat---ttacg
Q9JM54_PMAIP1-02       -ggattggagacaaag---------------------tgaat---ttacg
P62816_HRK-03          tgggcgacgagctgca---------------------ccgacgcgccatg
O70337_BIK-04          ttgattcgaagcctca---------------------ccaac---ctcag
O70337_BIK-01          ttgattcgaagcctca---------------------ccaac---ctcag
O70337_BIK-02          ttgattcgaagcctca---------------------ccaac---ctcag
O70337_BIK-03          ttgattcgaagcctca---------------------ccaac---ctcag
B2RVL4_BBC3-01         -gg----gggcccccg---------------------ctggc---ctggg
Q99ML1_BBC3-01         -gg----gggcccccg---------------------ctggc---ctggg
Q99ML1_BBC3-02         -gg----gggcccccg---------------------ctggc---ctggg
Q99ML1_BBC3-03         -gg----gggcccccg---------------------ctggc---ctggg
Q91ZE9_BMF-02          cag----ggtgtcatg---------------------ctgcc---ttgtg
Q91ZE9_BMF-01          cag----ggtgtcatg---------------------ctgcc---ttgtg
Q91ZE9_BMF-06          cag----ggtgtcatg---------------------ctgcc---ttgtg

O54918_BCL2L11-03      ----------------------------------------------tgca
O54918_BCL2L11-01      gaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcg
O54918_BCL2L11-05      gaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcg
O54918_BCL2L11-06      gaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcg
O54918_BCL2L11-08      gaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcg
Q61337_BAD-09          tttcattt--------aggatcccggcacacgcatcatcccgtgtc----
Q61337_BAD-07          ----------------agcatgctgggacttgcagtt-ctaatccg----
Q61337_BAD-02          gga-----------gaagagctgacgtac---------------------
Q61337_BAD-05          gt---------------gagcgccagcgt-t--------aggtgcga---
Q61337_BAD-01          ggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaa
Q61337_BAD-03          ggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaa
Q61337_BAD-04          ggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaa
Q61337_BAD-06          ggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaa
Q9JM54_PMAIP1-03       g---------------------cagaaacttctg----aatttgatttcc
Q9JM54_PMAIP1-01       g---------------------cagaaacttctg----aatttgatttcc
Q9JM54_PMAIP1-02       g---------------------cagaaacttctg----aatttgatttcc
P62816_HRK-03          cggcgtcgcgc-----gcggccccgggacccgctgcccgcgctgctgccc
O70337_BIK-04          ggaaaacatct-----g-gtcctggagagtcttg----------------
O70337_BIK-01          ggaaaacatct-----g-gtcctggagagtcttg----------------
O70337_BIK-02          ggaaaacatct-----g-gtcctggagagtcttg----------------
O70337_BIK-03          ggaaaacatct-----g-gtcctggagagtcttg----------------
B2RVL4_BBC3-01         ggtcaccgcag-----ccggcccagaggcccgcgcccgg-----------
Q99ML1_BBC3-01         ggtcaccgcag-----ccggcccagaggcccgcgcccgg-----------
Q99ML1_BBC3-02         ggtcaccgcag-----ccggcccagaggcccgcgcccgg-----------
Q99ML1_BBC3-03         ggtcaccgcag-----ccggcccagaggcccgcgcccgg-----------
Q91ZE9_BMF-02          gggtgacagag-----gaaccccagagactcttttacggcaacgctggct
Q91ZE9_BMF-01          gggtgacagag-----gaaccccagagactcttttacggcaacgctggct
Q91ZE9_BMF-06          gggtgacagag-----gaaccccagagactcttttacggcaacgctggct

O54918_BCL2L11-03      atggatcag-----------ttggagaatcttaaccaag--------tgg
O54918_BCL2L11-01      gcggatcggagacga---gttcaacgaaacttacacaaggagggtgtttg
O54918_BCL2L11-05      gcggatcggagacga---gttcaacgaaacttacacaaggagggtgtttg
O54918_BCL2L11-06      gcggatcggagacga---gttcaacgaaacttacacaaggagggtgtttg
O54918_BCL2L11-08      gcggatcggagacga---gttcaacgaaacttacacaaggagggtgtttg
Q61337_BAD-09          -------------------tctgaccgcccagtgcagagcaagctggtgg
Q61337_BAD-07          ---------------------tcctctctcagtgtccagtgatttgctgg
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          -----------------------------------------------tgg
Q61337_BAD-01          agcgcc------------ggctggacgcgcattatccagt--cctggtgg
Q61337_BAD-03          agcgcc------------ggctggacgcgcattatccagt--cctggtgg
Q61337_BAD-04          agcgcc------------ggctggacgcgcattatccagt--cctggtgg
Q61337_BAD-06          agcgcc------------ggctggacgcgcattatccagt--cctggtgg
Q9JM54_PMAIP1-03       aagctcttcaa---------------------------------------
Q9JM54_PMAIP1-01       aagctcttcaa---------------------------------------
Q9JM54_PMAIP1-02       aagctcttcaa---------------------------------------
P62816_HRK-03          gcgctccgcgcccgctggccctggctgtgcgcggccgcgca---------
O70337_BIK-04          --actcctggc-------gcctgggtgtcacctgaccagga---------
O70337_BIK-01          --actcctggc-------gcctgggtgtcacctgaccagga---------
O70337_BIK-02          --actcctggc-------gcctgggtgtcacctgaccagga---------
O70337_BIK-03          --actcctggc-------gcctgggtgtcacctgaccagga---------
B2RVL4_BBC3-01         acggtcctcag-------ccctccctgtcaccagcccagcagcacttaga
Q99ML1_BBC3-01         acg-----------------------------------------------
Q99ML1_BBC3-02         acggtcctcag-------ccctccctgtcaccagcccagcagcacttaga
Q99ML1_BBC3-03         acggtcctcag-------ccctccctgtcaccagcccagcagcacttaga
Q91ZE9_BMF-02          acaggcttc---------ctctccctgccagtttccctgcag--------
Q91ZE9_BMF-01          acaggcttc---------ctctccctgccagtttccctgcag--------
Q91ZE9_BMF-06          acaggcttc---------ctctccctgccagtttccctgcag--------

O54918_BCL2L11-03      cacaaaatatccacggtgat------------------------------
O54918_BCL2L11-01      caaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaa
O54918_BCL2L11-05      caaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaa
O54918_BCL2L11-06      caaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaa
O54918_BCL2L11-08      caaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaa
Q61337_BAD-09          t-------------------------ggggacctgattcgggatgccaga
Q61337_BAD-07          gatttcctccctcttcctcctttgtccaagaccccgtccccagtcccgg-
Q61337_BAD-02          -----------------------------------------------ag-
Q61337_BAD-05          gac-----------------------c-----------------------
Q61337_BAD-01          gat-----------------------cgaaacttgggcaaagg---agg-
Q61337_BAD-03          gat-----------------------cgaaacttgggcaaagg---agg-
Q61337_BAD-04          gat-----------------------cgaaacttgggcaaagg---agg-
Q61337_BAD-06          gat-----------------------cgaaacttgggcaaagg---agg-
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          -----------------------------------ggtggc---------
O70337_BIK-04          ------------------------------ccctgggcagctgtttccga
O70337_BIK-01          ------------------------------ccctgggcagctgtttccga
O70337_BIK-02          ------------------------------ccctgggcagctgtttccga
O70337_BIK-03          ------------------------------ccctgggcagctgtttccga
B2RVL4_BBC3-01         gtcgcccgtgcc--------------cagcgccccggaggccctggcagg
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         gtcgcccgtgcc--------------cagcgccccggaggccctggcagg
Q99ML1_BBC3-03         gtcgcccgtgcc--------------cagcgccccggaggccctggcagg
Q91ZE9_BMF-02          ---------gct--------------caccccttggggagcagccccctg
Q91ZE9_BMF-01          ---------gct--------------caccccttggggagcagccccctg
Q91ZE9_BMF-06          ---------gct--------------caccccttggggagcagccccctg

O54918_BCL2L11-03      -------------------gcctggtaca--------actga--------
O54918_BCL2L11-01      ctgttacgctttatcttccgtctggtatggagaaggcattga--------
O54918_BCL2L11-05      ctgttacgctttatcttccgtctggtatggagaaggcattga--------
O54918_BCL2L11-06      ctgttacgctttatcttccgtctggtatggagaaggcattga--------
O54918_BCL2L11-08      ctgttacgctttatcttccgtctggtatggagaaggcattga--------
Q61337_BAD-09          atgaggctcactctttcctcctcct-------------------------
Q61337_BAD-07          -------------tttatgccttca-------------------------
Q61337_BAD-02          -------------cttgagtccctt-------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          -------------ctccaccccctc-------------------------
Q61337_BAD-03          -------------ctccaccccctc-------------------------
Q61337_BAD-04          -------------ctccaccccctc-------------------------
Q61337_BAD-06          -------------ctccaccccctc-------------------------
Q9JM54_PMAIP1-03       ------------tttagtaacctga-------------------------
Q9JM54_PMAIP1-01       ------------tttagtaacctga-------------------------
Q9JM54_PMAIP1-02       ------------tttagtaacctga-------------------------
P62816_HRK-03          -ggcgctggcggcctggctgctcggcaggcggagcgcgtag---------
O70337_BIK-04          tggtgctgctggtcttcttgctgct-gggtggggcctggt----------
O70337_BIK-01          tggtgctgctggtcttcttgctgct-gggtggggcctggt----------
O70337_BIK-02          tggtgctgctggtcttcttgctgct-gggtggggcctggt----------
O70337_BIK-03          tggtgctgctggtcttcttgctgct-gggtggg-----------------
B2RVL4_BBC3-01         aggccccac---ccaagctgccccg-ggagtgcgtgtggaggaggaggag
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         aggccccac---ccaagctgccccg-ggagtgcgtgtggaggaggaggag
Q99ML1_BBC3-03         aggccccac---ccaagctgccccg-ggagtgcgtgtgga----------
Q91ZE9_BMF-02          aaggacagt---tccttcagcaccg-agcagaggtgcaga----------
Q91ZE9_BMF-01          aaggacagt---tccttcagcaccg-agcagaggtgcaga----------
Q91ZE9_BMF-06          aaggacagt---tccttcagcaccg-agcagaggtgcaga----------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         tgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaa
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         tgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaa
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          -------------tcgccagaaagcttcagtgtattgcagaccagttcca
Q91ZE9_BMF-01          -------------tcgccagaaagcttcagtgtattgcagaccagttcca
Q91ZE9_BMF-06          -------------tcgccagaaagcttcagtgtattgcagaccagttcca

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         cgcgcagtacgagcggcggagacaagaagagcagcatcgacaccgaccct
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         cgcgcagtacgagcggcggagacaagaagagcagcatcgacaccgaccct
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          tcggcttcatacgc------aacaacaccagcagaaccgagaccgtgcgt
Q91ZE9_BMF-01          tcggcttcatacgc------aacaacaccagcagaaccgagaccgtgcgt
Q91ZE9_BMF-06          tcggcttcatacgc------aacaacaccagcagaaccgagaccgtgcgt

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      --------------------------------------------------
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
Q9JM54_PMAIP1-03       --------------------------------------------------
Q9JM54_PMAIP1-01       --------------------------------------------------
Q9JM54_PMAIP1-02       --------------------------------------------------
P62816_HRK-03          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
B2RVL4_BBC3-01         caccctggagggtcatgtacaatctcttcatgggactcctccccttaccc
Q99ML1_BBC3-01         --------------------------------------------------
Q99ML1_BBC3-02         caccctggagggtcatgtacaatctcttcatgggactcctccccttaccc
Q99ML1_BBC3-03         --------------------------------------------------
Q91ZE9_BMF-02          gg---tggcaggtctt------ccttttccttcaaaacctcgccctgaac
Q91ZE9_BMF-01          gg---tggcaggtctt------ccttttccttcaaaacctcgccctgaac
Q91ZE9_BMF-06          gg---tggcaggtctt------ccttttccttcaaaacctcgccctgaac

O54918_BCL2L11-03      ---------------------------------------------
O54918_BCL2L11-01      ---------------------------------------------
O54918_BCL2L11-05      ---------------------------------------------
O54918_BCL2L11-06      ---------------------------------------------
O54918_BCL2L11-08      ---------------------------------------------
Q61337_BAD-09          -----------------------------tccctga---------
Q61337_BAD-07          -----------------------------cctgtaa---------
Q61337_BAD-02          -----------------------------ccggtgcgtgcaatag
Q61337_BAD-05          ---------------------------------tga---------
Q61337_BAD-01          -----------------------------ccagtga---------
Q61337_BAD-03          -----------------------------ccagtga---------
Q61337_BAD-04          -----------------------------ccagtga---------
Q61337_BAD-06          -----------------------------ccagtga---------
Q9JM54_PMAIP1-03       ---------------------------------------------
Q9JM54_PMAIP1-01       ---------------------------------------------
Q9JM54_PMAIP1-02       ---------------------------------------------
P62816_HRK-03          ---------------------------------------------
O70337_BIK-04          -------------------atttgcagcttcagtga---------
O70337_BIK-01          -------------------atttgcagcttcagtga---------
O70337_BIK-02          -------------------atttgcagcttcagtga---------
O70337_BIK-03          ---------------------------------------------
B2RVL4_BBC3-01         agggatcctggagccccagaaatggagcccaactag---------
Q99ML1_BBC3-01         ---------------------------------------------
Q99ML1_BBC3-02         agggatcctggagccccagaaatggagcccaactag---------
Q99ML1_BBC3-03         ---------------------------------------------
Q91ZE9_BMF-02          agacaagaaaacagggaaggggtggggccctggtga---------
Q91ZE9_BMF-01          agacaagaaaacagggaaggggtggggccctggtga---------
Q91ZE9_BMF-06          agacaagaaaacagggaaggggtggggccctggtga---------

© 1998-2021Legal notice