Dataset for CDS classical BH3-containing proteins of organism Malurus cyaneus samueli

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C5THT3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Malurus cyaneus samueli GN=BMF (length=582 residues).
atggatcgtcccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatccgcacctccaagaggaacctcaggaaggtcagc
gggaagcacgtgcagaggtgcagattgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacgcggaggtgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A8C5TVU9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL2L11 (length=252 residues).
acatacaaatccaactgtgagttttatggagtacagtctgtacaatttgttcttgcccttggttccaatgctcccacttt
gtcccatgcagcttcccggtggcagtcccactctccagccgaagaggtgcagccggaaatctggattgcccaggagctga
gacgcatcggggacgagttcaatgcctcctattgtccacgcagggtaactttcctctcttcactctccatttctctcaaa
gggaaaggctga
>gnl|bcl2dbcds|A0A8C5UI47_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL2L11 (length=654 residues).
atggggcggggggcggggggtcgggccggccccggcgcgctcggccgctcaccgcgctccgctccccgcaggcagcccga
tggccaagcagcccccgaggtgaaggcgcgacgcgacggcgagggcgggcggctgccggcggcggagggccgggcccggg
cgcgcagctgcgcccggcgcccccgccgcctgcccgggccgggccggcccggtgtcgccgccgccgcggcgcggggcccg
ccgaccggccccttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccgctgctgccgcgctcctccagtgg
gtacttctcgttcgaagccgagcgcagccccgcgcccctgggctgcgacaaggccacgcagacccccagcccgccctgcc
aggcgctcagccactgcctcagcgccatggcttcccggtggcagtcccactctccagccgaagaggtgcagccggaaatc
tggattgcccaggagctgagctcactgctttgtttggtttttctctcttttttgttttgttttgtttttctccctctttt
tcagggtttcttggatttccaggtggggaacccccaggtggtgatcctgcgcctgctgcgttacatcatccgcctcatct
ggaggctccagtga
© 1998-2022Legal notice